Incidental Mutation 'R3897:Rnf144a'
ID309021
Institutional Source Beutler Lab
Gene Symbol Rnf144a
Ensembl Gene ENSMUSG00000020642
Gene Namering finger protein 144A
SynonymsUIP4, Rnf144
MMRRC Submission 040808-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3897 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location26300964-26415254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26310713 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 275 (V275A)
Ref Sequence ENSEMBL: ENSMUSP00000056073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020971] [ENSMUST00000062149]
Predicted Effect probably damaging
Transcript: ENSMUST00000020971
AA Change: V275A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020971
Gene: ENSMUSG00000020642
AA Change: V275A

DomainStartEndE-ValueType
RING 20 68 2.17e-1 SMART
IBR 91 156 6.4e-19 SMART
IBR 168 232 9.16e-1 SMART
RING 185 280 1.58e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000062149
AA Change: V275A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056073
Gene: ENSMUSG00000020642
AA Change: V275A

DomainStartEndE-ValueType
RING 20 68 2.17e-1 SMART
IBR 91 156 6.4e-19 SMART
IBR 168 232 9.16e-1 SMART
RING 185 280 1.58e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223137
Meta Mutation Damage Score 0.2247 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of RING finger domain-containing E3 ubiquitin ligases that also includes parkin and parc. The expression of this gene is induced by DNA damage. The encoded protein interacts with the cytoplasmic DNA-dependent protein kinase, catalytic subunit (DNA-PKcs) and promotes its degradation through ubiquitination. The orthologous mouse protein has been shown to interact with a ubiquitin-conjugating enzyme involved in embryonic development. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,438 D316G possibly damaging Het
Adam15 T C 3: 89,346,938 H184R probably benign Het
Ap1g1 A G 8: 109,854,999 D633G probably damaging Het
Arhgef28 C T 13: 97,956,576 R999H probably damaging Het
Armc3 T C 2: 19,269,177 S341P probably damaging Het
Cmya5 T C 13: 93,096,681 E633G possibly damaging Het
Colgalt1 G A 8: 71,619,662 M275I probably damaging Het
Commd7 T C 2: 153,622,790 T23A probably benign Het
Cts3 A G 13: 61,564,986 Y307H probably benign Het
Dlgap4 C A 2: 156,746,069 P89Q probably damaging Het
Ecm1 A G 3: 95,735,986 L334P probably damaging Het
Fzd8 G A 18: 9,214,939 V674I possibly damaging Het
Gosr2 A G 11: 103,697,646 Y5H possibly damaging Het
Gria4 T A 9: 4,513,260 D283V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqcm C T 8: 75,753,400 R329C probably damaging Het
Kdm4b T C 17: 56,396,955 C233R probably damaging Het
Ltbp1 T C 17: 75,274,016 C391R probably damaging Het
Man2b1 G T 8: 85,096,948 probably benign Het
Nisch A G 14: 31,191,000 probably benign Het
Nrxn2 T G 19: 6,519,257 D1394E probably damaging Het
Olfr1259 T C 2: 89,943,809 E102G probably benign Het
Olfr1283 T C 2: 111,368,761 L43P possibly damaging Het
Pabpc6 T C 17: 9,669,127 D165G probably benign Het
Psat1 A G 19: 15,919,453 probably null Het
Psd A C 19: 46,324,585 N115K possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc35b3 A G 13: 38,934,763 F356L probably benign Het
Tmc4 A G 7: 3,671,088 V364A probably benign Het
Tmem203 T C 2: 25,255,923 F85S probably benign Het
Tra2a T C 6: 49,245,542 probably benign Het
Ttc21b C T 2: 66,235,069 E454K probably benign Het
Other mutations in Rnf144a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Rnf144a APN 12 26327301 missense probably benign 0.01
IGL02709:Rnf144a APN 12 26321010 missense probably damaging 1.00
R0432:Rnf144a UTSW 12 26339329 missense probably damaging 1.00
R4087:Rnf144a UTSW 12 26327592 missense probably damaging 1.00
R4504:Rnf144a UTSW 12 26327303 missense probably benign 0.11
R5985:Rnf144a UTSW 12 26317780 missense probably benign 0.04
R6392:Rnf144a UTSW 12 26310780 missense possibly damaging 0.93
R7827:Rnf144a UTSW 12 26339440 start codon destroyed probably null 0.89
R8431:Rnf144a UTSW 12 26327301 missense probably damaging 1.00
RF018:Rnf144a UTSW 12 26314014 critical splice donor site probably benign
RF036:Rnf144a UTSW 12 26314008 critical splice donor site probably benign
RF036:Rnf144a UTSW 12 26314013 critical splice donor site probably benign
RF043:Rnf144a UTSW 12 26314014 critical splice donor site probably benign
RF048:Rnf144a UTSW 12 26314011 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- CTGAAATCTCTGCAGCAAGC -3'
(R):5'- AAAGATGGGCCCATGGATGC -3'

Sequencing Primer
(F):5'- CCGGACACTGAAGCTCAATGG -3'
(R):5'- ATGGATGCATGCGTGACTC -3'
Posted On2015-04-17