Incidental Mutation 'R3897:Slc35b3'
ID 309022
Institutional Source Beutler Lab
Gene Symbol Slc35b3
Ensembl Gene ENSMUSG00000021432
Gene Name solute carrier family 35, member B3
Synonyms 4921526O06Rik, PAPST2
MMRRC Submission 040808-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock # R3897 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 38932136-38960875 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38934763 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 356 (F356L)
Ref Sequence ENSEMBL: ENSMUSP00000021870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021870] [ENSMUST00000167513] [ENSMUST00000224429] [ENSMUST00000224645] [ENSMUST00000225396] [ENSMUST00000225432] [ENSMUST00000225461] [ENSMUST00000225568] [ENSMUST00000225714]
AlphaFold Q922Q5
Predicted Effect probably benign
Transcript: ENSMUST00000021870
AA Change: F356L

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021870
Gene: ENSMUSG00000021432
AA Change: F356L

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:UAA 92 383 3.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167513
AA Change: F312L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126016
Gene: ENSMUSG00000021432
AA Change: F312L

DomainStartEndE-ValueType
Pfam:UAA 49 343 4e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223619
Predicted Effect probably benign
Transcript: ENSMUST00000224429
Predicted Effect probably benign
Transcript: ENSMUST00000224645
AA Change: F139L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000225396
AA Change: F148L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000225432
AA Change: F312L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000225461
Predicted Effect probably benign
Transcript: ENSMUST00000225568
AA Change: F214L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000225714
Meta Mutation Damage Score 0.1115 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family. The encoded protein is involved in the transport of 3-prime phosphoadenosine 5-prime phosphosulfate (PAPS) from the nucleus or the cytosol to the Golgi lumen. This gene has been reported to be expressed preferentially in the human colon tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,438 D316G possibly damaging Het
Adam15 T C 3: 89,346,938 H184R probably benign Het
Ap1g1 A G 8: 109,854,999 D633G probably damaging Het
Arhgef28 C T 13: 97,956,576 R999H probably damaging Het
Armc3 T C 2: 19,269,177 S341P probably damaging Het
Cmya5 T C 13: 93,096,681 E633G possibly damaging Het
Colgalt1 G A 8: 71,619,662 M275I probably damaging Het
Commd7 T C 2: 153,622,790 T23A probably benign Het
Cts3 A G 13: 61,564,986 Y307H probably benign Het
Dlgap4 C A 2: 156,746,069 P89Q probably damaging Het
Ecm1 A G 3: 95,735,986 L334P probably damaging Het
Fzd8 G A 18: 9,214,939 V674I possibly damaging Het
Gosr2 A G 11: 103,697,646 Y5H possibly damaging Het
Gria4 T A 9: 4,513,260 D283V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqcm C T 8: 75,753,400 R329C probably damaging Het
Kdm4b T C 17: 56,396,955 C233R probably damaging Het
Ltbp1 T C 17: 75,274,016 C391R probably damaging Het
Man2b1 G T 8: 85,096,948 probably benign Het
Nisch A G 14: 31,191,000 probably benign Het
Nrxn2 T G 19: 6,519,257 D1394E probably damaging Het
Olfr1259 T C 2: 89,943,809 E102G probably benign Het
Olfr1283 T C 2: 111,368,761 L43P possibly damaging Het
Pabpc6 T C 17: 9,669,127 D165G probably benign Het
Psat1 A G 19: 15,919,453 probably null Het
Psd A C 19: 46,324,585 N115K possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnf144a A G 12: 26,310,713 V275A probably damaging Het
Tmc4 A G 7: 3,671,088 V364A probably benign Het
Tmem203 T C 2: 25,255,923 F85S probably benign Het
Tra2a T C 6: 49,245,542 probably benign Het
Ttc21b C T 2: 66,235,069 E454K probably benign Het
Other mutations in Slc35b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Slc35b3 APN 13 38943140 missense possibly damaging 0.82
IGL02111:Slc35b3 APN 13 38955782 missense probably damaging 0.99
R0883:Slc35b3 UTSW 13 38937275 missense probably benign 0.09
R1170:Slc35b3 UTSW 13 38937331 missense probably benign 0.03
R1440:Slc35b3 UTSW 13 38954134 nonsense probably null
R1653:Slc35b3 UTSW 13 38955798 missense probably benign 0.02
R1900:Slc35b3 UTSW 13 38960611 critical splice donor site probably null
R3874:Slc35b3 UTSW 13 38943068 missense possibly damaging 0.66
R4399:Slc35b3 UTSW 13 38937815 missense possibly damaging 0.95
R4937:Slc35b3 UTSW 13 38932911 missense possibly damaging 0.89
R4955:Slc35b3 UTSW 13 38932890 missense probably benign 0.08
R5034:Slc35b3 UTSW 13 38943158 missense probably damaging 1.00
R5770:Slc35b3 UTSW 13 38937758 missense probably damaging 0.98
R6155:Slc35b3 UTSW 13 38944596 missense probably damaging 1.00
R6663:Slc35b3 UTSW 13 38954136 missense probably damaging 0.99
R7701:Slc35b3 UTSW 13 38944635 missense probably benign 0.03
R8534:Slc35b3 UTSW 13 38944590 missense probably benign 0.17
R8796:Slc35b3 UTSW 13 38937746 critical splice donor site probably benign
R8950:Slc35b3 UTSW 13 38954121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGGCTTAGCTGGGTAAC -3'
(R):5'- ATTTGATTTGATCAGTGCCAGG -3'

Sequencing Primer
(F):5'- ACTGGGCTTAGCTGGGTAACTTAAG -3'
(R):5'- GGATCTTAGTGATTCTGGCAGACAC -3'
Posted On 2015-04-17