Mutagenetix > Incidental Mutations

Incidental Mutation 'R3898:Dnah7b'

309034

Institutional Source

Beutler Lab

Gene Symbol

Dnah7b

Ensembl Gene

ENSMUSG00000041144

Gene Name

dynein, axonemal, heavy chain 7B

Synonyms

Dnahc7b, LOC227058

MMRRC Submission

040906-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R3898 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46066315-46373546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46243257 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2850 (V2850A)

Ref Sequence

ENSEMBL: ENSMUSP00000068738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069293]

Predicted Effect

probably damaging
Transcript: ENSMUST00000069293
AA Change: V2850A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: V2850A

Domain	Start	End	E-Value	Type
coiled coil region	760	790	N/A	INTRINSIC
Pfam:DHC_N2	800	1209	3.7e-150	PFAM
AAA	1364	1503	3.24e-1	SMART
AAA	2012	2160	5.39e-2	SMART
Pfam:AAA_8	2347	2618	2.4e-75	PFAM
Pfam:MT	2630	2979	2.6e-54	PFAM
Pfam:AAA_9	3001	3226	2.3e-98	PFAM
Pfam:Dynein_heavy	3362	4064	8.4e-288	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187548

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028P14Rik	A	G	19: 23,593,102	V101A	probably benign	Het
Alg1	A	C	16: 5,236,389	I154L	possibly damaging	Het
Ankra2	C	T	13: 98,273,809	L136F	probably benign	Het
Anpep	A	G	7: 79,839,225	S372P	probably benign	Het
Cabyr	T	C	18: 12,751,523	S356P	probably benign	Het
Cad	G	T	5: 31,074,022	C1633F	probably benign	Het
Cadps2	G	A	6: 23,528,126	R425W	probably damaging	Het
Ccdc180	A	G	4: 45,912,799	K593E	possibly damaging	Het
Cdh8	T	A	8: 99,171,373	E436V	probably damaging	Het
Cln6	T	G	9: 62,850,652	F231C	probably damaging	Het
Cul2	A	G	18: 3,434,033	K677E	probably benign	Het
Cyp2c69	T	C	19: 39,876,390	I215V	probably benign	Het
Dhx36	T	C	3: 62,492,369	D393G	probably damaging	Het
Dnah8	G	A	17: 30,854,898	R4514H	probably damaging	Het
Drg2	T	A	11: 60,456,634	S50T	probably benign	Het
Ecscr	A	G	18: 35,713,652	S230P	possibly damaging	Het
Eif2ak4	T	C	2: 118,430,923	V527A	probably damaging	Het
Elfn1	G	A	5: 139,971,964	R241H	probably damaging	Het
Fchsd2	A	G	7: 101,191,799	K172E	possibly damaging	Het
Fli1	C	T	9: 32,476,722	G24R	possibly damaging	Het
Frmd3	A	G	4: 74,074,109	D71G	probably damaging	Het
Ggnbp1	A	G	17: 27,025,338		probably benign	Het
Gpat2	T	C	2: 127,435,098	F713S	probably damaging	Het
H2-Q2	C	T	17: 35,342,767	P78S	probably damaging	Het
Kcnq2	C	T	2: 181,109,686	A306T	probably damaging	Het
Lmntd1	G	A	6: 145,413,426	P333S	probably benign	Het
Lrp1	G	A	10: 127,592,100	R535*	probably null	Het
Mmrn2	G	T	14: 34,399,560		probably null	Het
Nlrp1a	G	A	11: 71,122,874	P517S	probably benign	Het
Olfr1383	A	T	11: 49,524,559	I279F	probably damaging	Het
Pou4f1	T	C	14: 104,465,729	*422W	probably null	Het
Ptpn14	C	T	1: 189,850,531	P525L	probably benign	Het
Pyroxd2	C	A	19: 42,740,392	G190C	probably damaging	Het
Rd3	T	C	1: 191,985,256	V114A	probably damaging	Het
Sptbn5	T	C	2: 120,057,210		noncoding transcript	Het
Tbc1d5	A	T	17: 50,963,744	F153Y	probably damaging	Het
Thop1	G	A	10: 81,080,444	G429S	probably damaging	Het
Trim30d	T	A	7: 104,483,529	I184L	probably benign	Het
Ubr5	T	C	15: 37,997,739	S1727G	probably benign	Het
Vezf1	T	C	11: 88,076,173	F77L	probably benign	Het
Vmn2r12	C	T	5: 109,090,504	A457T	probably benign	Het
Xirp1	A	T	9: 120,019,340	M159K	probably benign	Het
Zkscan17	C	T	11: 59,503,437	A113T	probably damaging	Het
Zyg11a	T	A	4: 108,210,194	N40Y	probably damaging	Het

Other mutations in Dnah7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Dnah7b	APN	1	46142149	missense	probably benign	0.04
IGL00796:Dnah7b	APN	1	46211337	missense	probably damaging	0.96
IGL00825:Dnah7b	APN	1	46224651	missense	probably damaging	1.00
IGL00910:Dnah7b	APN	1	46066729	unclassified	probably benign
IGL00950:Dnah7b	APN	1	46214322	missense	probably benign	0.07
IGL01142:Dnah7b	APN	1	46195378	critical splice donor site	probably null
IGL01350:Dnah7b	APN	1	46081432	splice site	probably benign
IGL01392:Dnah7b	APN	1	46126788	missense	probably damaging	1.00
IGL01403:Dnah7b	APN	1	46116300	splice site	probably benign
IGL01460:Dnah7b	APN	1	46139704	missense	possibly damaging	0.82
IGL01576:Dnah7b	APN	1	46268653	missense	probably damaging	1.00
IGL01693:Dnah7b	APN	1	46358147	missense	probably benign	0.29
IGL01838:Dnah7b	APN	1	46358137	nonsense	probably null
IGL01906:Dnah7b	APN	1	46175453	missense	probably damaging	1.00
IGL01960:Dnah7b	APN	1	46124337	splice site	probably benign
IGL01989:Dnah7b	APN	1	46289534	missense	probably damaging	1.00
IGL02127:Dnah7b	APN	1	46139875	missense	probably benign
IGL02213:Dnah7b	APN	1	46233592	missense	probably damaging	0.97
IGL02267:Dnah7b	APN	1	46226930	missense	probably damaging	1.00
IGL02349:Dnah7b	APN	1	46099503	nonsense	probably null
IGL02381:Dnah7b	APN	1	46277120	missense	probably damaging	1.00
IGL02473:Dnah7b	APN	1	46234193	missense	probably damaging	1.00
IGL02484:Dnah7b	APN	1	46195318	missense	probably damaging	1.00
IGL02590:Dnah7b	APN	1	46123777	missense	probably benign	0.02
IGL02655:Dnah7b	APN	1	46116301	splice site	probably benign
IGL02704:Dnah7b	APN	1	46142133	missense	probably benign	0.03
IGL02719:Dnah7b	APN	1	46099608	splice site	probably benign
IGL02745:Dnah7b	APN	1	46195029	splice site	probably benign
IGL02818:Dnah7b	APN	1	46290808	missense	probably damaging	1.00
IGL02892:Dnah7b	APN	1	46119298	missense	possibly damaging	0.79
IGL03285:Dnah7b	APN	1	46182375	missense	probably benign	0.00
IGL03354:Dnah7b	APN	1	46085689	missense	probably damaging	1.00
IGL03355:Dnah7b	APN	1	46119304	missense	probably benign	0.18
PIT4305001:Dnah7b	UTSW	1	46373348	missense	probably damaging	1.00
R0116:Dnah7b	UTSW	1	46213360	missense	possibly damaging	0.94
R0145:Dnah7b	UTSW	1	46223178	missense	probably damaging	1.00
R0230:Dnah7b	UTSW	1	46219348	missense	probably damaging	1.00
R0302:Dnah7b	UTSW	1	46123777	missense	probably benign	0.26
R0313:Dnah7b	UTSW	1	46207643	missense	probably damaging	1.00
R0317:Dnah7b	UTSW	1	46134656	missense	probably damaging	1.00
R0347:Dnah7b	UTSW	1	46240944	missense	probably damaging	1.00
R0352:Dnah7b	UTSW	1	46277126	missense	probably damaging	0.98
R0363:Dnah7b	UTSW	1	46236788	missense	probably damaging	0.99
R0379:Dnah7b	UTSW	1	46140176	missense	probably benign	0.00
R0502:Dnah7b	UTSW	1	46219544	missense	probably damaging	0.96
R0602:Dnah7b	UTSW	1	46324842	missense	probably damaging	1.00
R0631:Dnah7b	UTSW	1	46240992	missense	probably benign	0.02
R0664:Dnah7b	UTSW	1	46324842	missense	probably damaging	1.00
R0882:Dnah7b	UTSW	1	46340132	missense	probably benign	0.00
R0931:Dnah7b	UTSW	1	46099612	splice site	probably benign
R1035:Dnah7b	UTSW	1	46124448	missense	probably benign
R1147:Dnah7b	UTSW	1	46340266	missense	probably damaging	0.99
R1147:Dnah7b	UTSW	1	46340266	missense	probably damaging	0.99
R1166:Dnah7b	UTSW	1	46325810	missense	probably damaging	1.00
R1219:Dnah7b	UTSW	1	46340120	missense	probably benign	0.00
R1318:Dnah7b	UTSW	1	46099509	missense	possibly damaging	0.80
R1334:Dnah7b	UTSW	1	46322335	missense	probably damaging	0.99
R1429:Dnah7b	UTSW	1	46289656	missense	possibly damaging	0.84
R1440:Dnah7b	UTSW	1	46078593	splice site	probably benign
R1484:Dnah7b	UTSW	1	46137543	missense	probably benign	0.00
R1529:Dnah7b	UTSW	1	46177281	missense	probably damaging	1.00
R1544:Dnah7b	UTSW	1	46066797	missense	unknown
R1607:Dnah7b	UTSW	1	46290646	missense	probably damaging	1.00
R1609:Dnah7b	UTSW	1	46352966	missense	probably damaging	1.00
R1652:Dnah7b	UTSW	1	46175390	nonsense	probably null
R1681:Dnah7b	UTSW	1	46324712	nonsense	probably null
R1716:Dnah7b	UTSW	1	46191783	missense	probably damaging	1.00
R1753:Dnah7b	UTSW	1	46322335	missense	probably damaging	0.99
R1834:Dnah7b	UTSW	1	46233759	missense	possibly damaging	0.90
R1838:Dnah7b	UTSW	1	46116177	missense	probably benign	0.04
R1838:Dnah7b	UTSW	1	46277105	missense	probably damaging	1.00
R1898:Dnah7b	UTSW	1	46236714	missense	probably benign	0.02
R1962:Dnah7b	UTSW	1	46242103	missense	possibly damaging	0.95
R2001:Dnah7b	UTSW	1	46142087	missense	possibly damaging	0.69
R2049:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2076:Dnah7b	UTSW	1	46242321	nonsense	probably null
R2083:Dnah7b	UTSW	1	46241067	missense	possibly damaging	0.90
R2140:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2141:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2142:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2165:Dnah7b	UTSW	1	46097992	splice site	probably benign
R2172:Dnah7b	UTSW	1	46124512	missense	probably benign	0.12
R2239:Dnah7b	UTSW	1	46201184	splice site	probably benign
R2247:Dnah7b	UTSW	1	46277063	missense	probably damaging	1.00
R2267:Dnah7b	UTSW	1	46233915	missense	probably damaging	1.00
R2405:Dnah7b	UTSW	1	46362954	missense	probably benign	0.31
R2509:Dnah7b	UTSW	1	46195287	missense	probably damaging	0.96
R2895:Dnah7b	UTSW	1	46139741	missense	probably damaging	1.00
R2965:Dnah7b	UTSW	1	46207572	missense	probably damaging	1.00
R3013:Dnah7b	UTSW	1	46188687	critical splice donor site	probably null
R3022:Dnah7b	UTSW	1	46182423	missense	probably damaging	0.99
R3056:Dnah7b	UTSW	1	46268709	missense	possibly damaging	0.95
R3107:Dnah7b	UTSW	1	46352873	missense	probably benign	0.00
R3735:Dnah7b	UTSW	1	46299875	missense	probably benign	0.05
R3944:Dnah7b	UTSW	1	46137485	missense	probably damaging	1.00
R3983:Dnah7b	UTSW	1	46233711	missense	possibly damaging	0.88
R4041:Dnah7b	UTSW	1	46081495	missense	probably benign
R4172:Dnah7b	UTSW	1	46226946	missense	probably damaging	1.00
R4210:Dnah7b	UTSW	1	46137418	missense	possibly damaging	0.63
R4306:Dnah7b	UTSW	1	46221772	missense	probably damaging	0.99
R4391:Dnah7b	UTSW	1	46337594	splice site	probably null
R4414:Dnah7b	UTSW	1	46126680	missense	probably benign	0.00
R4495:Dnah7b	UTSW	1	46085632	missense	probably benign	0.00
R4660:Dnah7b	UTSW	1	46289536	missense	probably damaging	1.00
R4670:Dnah7b	UTSW	1	46078524	missense	probably damaging	1.00
R4675:Dnah7b	UTSW	1	46217157	missense	possibly damaging	0.89
R4685:Dnah7b	UTSW	1	46211328	missense	probably damaging	1.00
R4727:Dnah7b	UTSW	1	46207656	missense	probably damaging	1.00
R4735:Dnah7b	UTSW	1	46066955	missense	unknown
R4780:Dnah7b	UTSW	1	46353014	missense	probably benign
R4828:Dnah7b	UTSW	1	46128112	missense	possibly damaging	0.59
R4859:Dnah7b	UTSW	1	46356602	missense	probably damaging	1.00
R4865:Dnah7b	UTSW	1	46195074	missense	probably damaging	1.00
R4871:Dnah7b	UTSW	1	46081444	missense	probably benign	0.21
R4881:Dnah7b	UTSW	1	46201318	missense	probably damaging	1.00
R4902:Dnah7b	UTSW	1	46290775	missense	probably benign	0.04
R4960:Dnah7b	UTSW	1	46233726	missense	probably benign
R5000:Dnah7b	UTSW	1	46099503	nonsense	probably null
R5005:Dnah7b	UTSW	1	46242028	missense	probably damaging	0.99
R5026:Dnah7b	UTSW	1	46187363	missense	probably damaging	0.99
R5080:Dnah7b	UTSW	1	46182380	nonsense	probably null
R5174:Dnah7b	UTSW	1	46243349	missense	possibly damaging	0.83
R5178:Dnah7b	UTSW	1	46358216	missense	possibly damaging	0.50
R5244:Dnah7b	UTSW	1	46233858	missense	probably damaging	1.00
R5250:Dnah7b	UTSW	1	46373354	missense	probably damaging	1.00
R5350:Dnah7b	UTSW	1	46233689	missense	probably benign	0.16
R5380:Dnah7b	UTSW	1	46217191	missense	probably benign	0.18
R5387:Dnah7b	UTSW	1	46188659	missense	probably damaging	1.00
R5423:Dnah7b	UTSW	1	46358271	missense	probably benign	0.01
R5426:Dnah7b	UTSW	1	46242206	missense	possibly damaging	0.82
R5451:Dnah7b	UTSW	1	46242019	missense	possibly damaging	0.73
R5459:Dnah7b	UTSW	1	46109312	missense	probably null
R5479:Dnah7b	UTSW	1	46223105	missense	probably damaging	1.00
R5583:Dnah7b	UTSW	1	46242199	missense	probably benign	0.06
R5637:Dnah7b	UTSW	1	46356514	missense	possibly damaging	0.95
R5641:Dnah7b	UTSW	1	46268764	splice site	probably null
R5659:Dnah7b	UTSW	1	46352849	missense	probably damaging	1.00
R5739:Dnah7b	UTSW	1	46233992	missense	probably damaging	1.00
R5759:Dnah7b	UTSW	1	46277120	missense	probably damaging	1.00
R5821:Dnah7b	UTSW	1	46142132	missense	possibly damaging	0.91
R5874:Dnah7b	UTSW	1	46191725	missense	probably damaging	1.00
R5892:Dnah7b	UTSW	1	46337593	critical splice donor site	probably null
R5918:Dnah7b	UTSW	1	46221643	missense	probably benign
R5941:Dnah7b	UTSW	1	46187290	missense	probably damaging	1.00
R5965:Dnah7b	UTSW	1	46362987	missense	probably damaging	1.00
R5987:Dnah7b	UTSW	1	46119398	intron	probably null
R6041:Dnah7b	UTSW	1	46289645	missense	probably benign	0.04
R6043:Dnah7b	UTSW	1	46139789	missense	probably benign
R6049:Dnah7b	UTSW	1	46085602	missense	probably benign
R6131:Dnah7b	UTSW	1	46253466	missense	probably damaging	1.00
R6168:Dnah7b	UTSW	1	46290703	missense	probably damaging	1.00
R6195:Dnah7b	UTSW	1	46204269	missense	probably damaging	1.00
R6219:Dnah7b	UTSW	1	46233585	missense	probably benign	0.03
R6226:Dnah7b	UTSW	1	46126668	missense	probably benign	0.01
R6233:Dnah7b	UTSW	1	46204269	missense	probably damaging	1.00
R6247:Dnah7b	UTSW	1	46225888	missense	probably benign
R6273:Dnah7b	UTSW	1	46242316	missense	possibly damaging	0.94
R6279:Dnah7b	UTSW	1	46325886	missense	probably damaging	1.00
R6300:Dnah7b	UTSW	1	46325886	missense	probably damaging	1.00
R6330:Dnah7b	UTSW	1	46340175	missense	probably damaging	1.00
R6476:Dnah7b	UTSW	1	46242204	nonsense	probably null
R6494:Dnah7b	UTSW	1	46099431	missense	probably damaging	1.00
R6762:Dnah7b	UTSW	1	46224742	missense	probably benign	0.12
R6800:Dnah7b	UTSW	1	46340217	missense	possibly damaging	0.90
R6838:Dnah7b	UTSW	1	46191788	missense	probably damaging	1.00
R6937:Dnah7b	UTSW	1	46195120	missense	probably damaging	1.00
R6940:Dnah7b	UTSW	1	46119268	missense	probably benign	0.12
R6969:Dnah7b	UTSW	1	46358238	missense	probably damaging	1.00
R6993:Dnah7b	UTSW	1	46195139	critical splice donor site	probably null
R7040:Dnah7b	UTSW	1	46236809	missense	probably benign	0.01
R7117:Dnah7b	UTSW	1	46352813	critical splice acceptor site	probably null
R7135:Dnah7b	UTSW	1	46139710	missense	probably damaging	0.99
R7153:Dnah7b	UTSW	1	46126804	missense	probably benign	0.05
R7189:Dnah7b	UTSW	1	46242142	missense	probably damaging	1.00
R7237:Dnah7b	UTSW	1	46139966	missense	probably damaging	0.98
R7243:Dnah7b	UTSW	1	46083754	missense	probably benign
R7244:Dnah7b	UTSW	1	46277143	missense	probably damaging	0.99
R7248:Dnah7b	UTSW	1	46142085	missense	possibly damaging	0.83
R7318:Dnah7b	UTSW	1	46195372	missense	probably damaging	1.00
R7375:Dnah7b	UTSW	1	46303634	missense	probably damaging	1.00
R7483:Dnah7b	UTSW	1	46175419	missense	probably damaging	1.00
R7486:Dnah7b	UTSW	1	46290734	missense	probably damaging	1.00
R7498:Dnah7b	UTSW	1	46325765	missense	probably damaging	1.00
R7501:Dnah7b	UTSW	1	46356554	missense	probably damaging	1.00
R7513:Dnah7b	UTSW	1	46124346	missense	probably benign	0.06
R7547:Dnah7b	UTSW	1	46214413	missense	possibly damaging	0.82
R7620:Dnah7b	UTSW	1	46268634	missense	probably damaging	1.00
R7670:Dnah7b	UTSW	1	46109302	missense	probably benign
R7676:Dnah7b	UTSW	1	46234164	nonsense	probably null
R7731:Dnah7b	UTSW	1	46139745	missense	probably benign	0.00
R7760:Dnah7b	UTSW	1	46201253	missense	probably damaging	1.00
R7768:Dnah7b	UTSW	1	46137474	missense	probably benign
R7807:Dnah7b	UTSW	1	46214367	missense	probably benign
RF020:Dnah7b	UTSW	1	46373261	missense	possibly damaging	0.84
V8831:Dnah7b	UTSW	1	46373298	nonsense	probably null
X0023:Dnah7b	UTSW	1	46303577	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CCACAAGTCTTAACCATCAGTTTTC -3'
(R):5'- ATTTGCAATTGTCAGCACCTACC -3'

Sequencing Primer
(F):5'- TGGACTCTACAACTAGGTG -3'
(R):5'- TCCTGAACCTCATACAGG -3'

Posted On

2015-04-17