Incidental Mutation 'R3898:Rd3'
ID309037
Institutional Source Beutler Lab
Gene Symbol Rd3
Ensembl Gene ENSMUSG00000049353
Gene Nameretinal degeneration 3
Synonymsrd3, rd-3
MMRRC Submission 040906-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3898 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191977370-191988283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 191985256 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 114 (V114A)
Ref Sequence ENSEMBL: ENSMUSP00000138049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175680] [ENSMUST00000180463] [ENSMUST00000181512]
Predicted Effect probably damaging
Transcript: ENSMUST00000053463
AA Change: V229A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050188
Gene: ENSMUSG00000049353
AA Change: V229A

DomainStartEndE-ValueType
Pfam:RD3 120 248 3.3e-48 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000175680
AA Change: W91R
SMART Domains Protein: ENSMUSP00000135650
Gene: ENSMUSG00000049353
AA Change: W91R

DomainStartEndE-ValueType
Pfam:RD3 4 79 4.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180429
Predicted Effect probably damaging
Transcript: ENSMUST00000180463
AA Change: V114A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138049
Gene: ENSMUSG00000049353
AA Change: V114A

DomainStartEndE-ValueType
Pfam:RD3 4 134 2.2e-50 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000181512
AA Change: W91R
SMART Domains Protein: ENSMUSP00000137756
Gene: ENSMUSG00000049353
AA Change: W91R

DomainStartEndE-ValueType
Pfam:RD3 4 79 4.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226862
Meta Mutation Damage Score 0.3394 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinal protein that is associated with promyelocytic leukemia-gene product (PML) bodies in the nucleus. Mutations in this gene cause Leber congenital amaurosis type 12, a disease that results in retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit retinal degeneration, beginning at 3 weeks of age, characterized by complete loss of photoreceptor rod cells by 5 weeks, and cones by 8 weeks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,593,102 V101A probably benign Het
Alg1 A C 16: 5,236,389 I154L possibly damaging Het
Ankra2 C T 13: 98,273,809 L136F probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Cabyr T C 18: 12,751,523 S356P probably benign Het
Cad G T 5: 31,074,022 C1633F probably benign Het
Cadps2 G A 6: 23,528,126 R425W probably damaging Het
Ccdc180 A G 4: 45,912,799 K593E possibly damaging Het
Cdh8 T A 8: 99,171,373 E436V probably damaging Het
Cln6 T G 9: 62,850,652 F231C probably damaging Het
Cul2 A G 18: 3,434,033 K677E probably benign Het
Cyp2c69 T C 19: 39,876,390 I215V probably benign Het
Dhx36 T C 3: 62,492,369 D393G probably damaging Het
Dnah7b T C 1: 46,243,257 V2850A probably damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drg2 T A 11: 60,456,634 S50T probably benign Het
Ecscr A G 18: 35,713,652 S230P possibly damaging Het
Eif2ak4 T C 2: 118,430,923 V527A probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Fli1 C T 9: 32,476,722 G24R possibly damaging Het
Frmd3 A G 4: 74,074,109 D71G probably damaging Het
Ggnbp1 A G 17: 27,025,338 probably benign Het
Gpat2 T C 2: 127,435,098 F713S probably damaging Het
H2-Q2 C T 17: 35,342,767 P78S probably damaging Het
Kcnq2 C T 2: 181,109,686 A306T probably damaging Het
Lmntd1 G A 6: 145,413,426 P333S probably benign Het
Lrp1 G A 10: 127,592,100 R535* probably null Het
Mmrn2 G T 14: 34,399,560 probably null Het
Nlrp1a G A 11: 71,122,874 P517S probably benign Het
Olfr1383 A T 11: 49,524,559 I279F probably damaging Het
Pou4f1 T C 14: 104,465,729 *422W probably null Het
Ptpn14 C T 1: 189,850,531 P525L probably benign Het
Pyroxd2 C A 19: 42,740,392 G190C probably damaging Het
Sptbn5 T C 2: 120,057,210 noncoding transcript Het
Tbc1d5 A T 17: 50,963,744 F153Y probably damaging Het
Thop1 G A 10: 81,080,444 G429S probably damaging Het
Trim30d T A 7: 104,483,529 I184L probably benign Het
Ubr5 T C 15: 37,997,739 S1727G probably benign Het
Vezf1 T C 11: 88,076,173 F77L probably benign Het
Vmn2r12 C T 5: 109,090,504 A457T probably benign Het
Xirp1 A T 9: 120,019,340 M159K probably benign Het
Zkscan17 C T 11: 59,503,437 A113T probably damaging Het
Zyg11a T A 4: 108,210,194 N40Y probably damaging Het
Other mutations in Rd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Rd3 APN 1 191985322 missense possibly damaging 0.84
IGL02319:Rd3 APN 1 191983491 missense probably null 1.00
R0098:Rd3 UTSW 1 191985300 missense probably benign 0.05
R0098:Rd3 UTSW 1 191985300 missense probably benign 0.05
R0458:Rd3 UTSW 1 191977453 missense probably damaging 0.96
R0537:Rd3 UTSW 1 191983540 missense probably damaging 1.00
R0991:Rd3 UTSW 1 191985238 missense probably damaging 0.98
R1344:Rd3 UTSW 1 191985301 makesense probably null
R2168:Rd3 UTSW 1 191983527 missense probably damaging 0.97
R3899:Rd3 UTSW 1 191985256 missense probably damaging 1.00
R3900:Rd3 UTSW 1 191985256 missense probably damaging 1.00
R5870:Rd3 UTSW 1 191985300 missense probably benign 0.00
R8047:Rd3 UTSW 1 191977659
Predicted Primers PCR Primer
(F):5'- TCAGGCTCCTTGCATATGAGC -3'
(R):5'- CGAGATGGTTCGGATGTCACTG -3'

Sequencing Primer
(F):5'- AAGGCAGGTGTACCCTTTTACAG -3'
(R):5'- TTCGGATGTCACTGGCAAAG -3'
Posted On2015-04-17