Incidental Mutation 'R0379:Crem'
Institutional Source Beutler Lab
Gene Symbol Crem
Ensembl Gene ENSMUSG00000063889
Gene NamecAMP responsive element modulator
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R0379 (G1)
Quality Score225
Status Validated
Chromosomal Location3266048-3337748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3299226 bp
Amino Acid Change Valine to Aspartic acid at position 82 (V82D)
Ref Sequence ENSEMBL: ENSMUSP00000127353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025069] [ENSMUST00000082141] [ENSMUST00000122958] [ENSMUST00000123672] [ENSMUST00000126578] [ENSMUST00000129435] [ENSMUST00000130455] [ENSMUST00000130599] [ENSMUST00000131899] [ENSMUST00000134027] [ENSMUST00000136961] [ENSMUST00000150235] [ENSMUST00000146265] [ENSMUST00000154715] [ENSMUST00000142690] [ENSMUST00000154470] [ENSMUST00000156234] [ENSMUST00000165086] [ENSMUST00000137568] [ENSMUST00000144496] [ENSMUST00000151311] [ENSMUST00000149803] [ENSMUST00000152108] [ENSMUST00000148305] [ENSMUST00000152900] [ENSMUST00000154135]
Predicted Effect probably damaging
Transcript: ENSMUST00000025069
AA Change: V82D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025069
Gene: ENSMUSG00000063889
AA Change: V82D

low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 3.1e-20 PFAM
BRLZ 285 343 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082141
SMART Domains Protein: ENSMUSP00000080780
Gene: ENSMUSG00000063889

Pfam:pKID 63 104 2.6e-20 PFAM
BRLZ 248 306 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122958
AA Change: V29D

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121118
Gene: ENSMUSG00000063889
AA Change: V29D

low complexity region 24 35 N/A INTRINSIC
Pfam:pKID 59 100 7.8e-21 PFAM
BRLZ 244 301 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123672
SMART Domains Protein: ENSMUSP00000120557
Gene: ENSMUSG00000063889

Pfam:pKID 47 88 1.5e-20 PFAM
BRLZ 157 214 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126578
AA Change: V29D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114780
Gene: ENSMUSG00000063889
AA Change: V29D

low complexity region 24 35 N/A INTRINSIC
Pfam:pKID 59 100 7.8e-21 PFAM
BRLZ 244 302 3.8e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000127601
AA Change: V67D
SMART Domains Protein: ENSMUSP00000118649
Gene: ENSMUSG00000063889
AA Change: V67D

low complexity region 63 74 N/A INTRINSIC
Pfam:pKID 98 139 3.1e-21 PFAM
BRLZ 271 328 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129435
SMART Domains Protein: ENSMUSP00000117438
Gene: ENSMUSG00000063889

Pfam:pKID 10 51 5.6e-21 PFAM
BRLZ 183 240 2.73e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130047
Predicted Effect probably damaging
Transcript: ENSMUST00000130455
AA Change: V72D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121541
Gene: ENSMUSG00000063889
AA Change: V72D

low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.8e-20 PFAM
BRLZ 275 333 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130599
SMART Domains Protein: ENSMUSP00000115471
Gene: ENSMUSG00000063889

Pfam:pKID 47 88 1.6e-20 PFAM
BRLZ 169 226 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131899
AA Change: V72D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119353
Gene: ENSMUSG00000063889
AA Change: V72D

low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.2e-20 PFAM
BRLZ 224 282 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134027
Predicted Effect probably benign
Transcript: ENSMUST00000136961
SMART Domains Protein: ENSMUSP00000115363
Gene: ENSMUSG00000063889

Pfam:pKID 35 76 6.5e-21 PFAM
BRLZ 208 265 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150235
AA Change: V82D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121233
Gene: ENSMUSG00000063889
AA Change: V82D

low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 1.1e-20 PFAM
BRLZ 297 354 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146265
AA Change: V72D

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119638
Gene: ENSMUSG00000063889
AA Change: V72D

low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.1e-20 PFAM
BRLZ 212 269 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154715
AA Change: V54D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122179
Gene: ENSMUSG00000063889
AA Change: V54D

low complexity region 49 60 N/A INTRINSIC
Pfam:pKID 84 125 8.7e-21 PFAM
BRLZ 269 327 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142690
AA Change: V66D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122282
Gene: ENSMUSG00000063889
AA Change: V66D

low complexity region 61 72 N/A INTRINSIC
Pfam:pKID 96 138 4.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154470
AA Change: V82D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118128
Gene: ENSMUSG00000063889
AA Change: V82D

low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 2.3e-20 PFAM
BRLZ 222 280 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156234
AA Change: V66D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121388
Gene: ENSMUSG00000063889
AA Change: V66D

low complexity region 61 72 N/A INTRINSIC
Pfam:pKID 96 137 9.1e-21 PFAM
BRLZ 281 339 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165086
AA Change: V82D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127353
Gene: ENSMUSG00000063889
AA Change: V82D

low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 2.4e-20 PFAM
BRLZ 234 292 3.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149266
Predicted Effect probably benign
Transcript: ENSMUST00000137568
SMART Domains Protein: ENSMUSP00000115336
Gene: ENSMUSG00000063889

Pfam:pKID 53 94 1.5e-20 PFAM
BRLZ 163 221 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144496
SMART Domains Protein: ENSMUSP00000120349
Gene: ENSMUSG00000063889

Pfam:pKID 35 76 6.9e-21 PFAM
BRLZ 220 277 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151311
SMART Domains Protein: ENSMUSP00000118267
Gene: ENSMUSG00000063889

Pfam:pKID 63 104 7.5e-21 PFAM
BRLZ 236 293 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149803
SMART Domains Protein: ENSMUSP00000121210
Gene: ENSMUSG00000063889

Pfam:pKID 47 89 2.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152108
SMART Domains Protein: ENSMUSP00000122241
Gene: ENSMUSG00000063889

Pfam:pKID 35 76 4.7e-21 PFAM
BRLZ 157 214 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148305
Predicted Effect probably benign
Transcript: ENSMUST00000152900
SMART Domains Protein: ENSMUSP00000123515
Gene: ENSMUSG00000063889

Pfam:pKID 53 94 2.4e-20 PFAM
BRLZ 238 296 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154135
SMART Domains Protein: ENSMUSP00000122051
Gene: ENSMUSG00000063889

Pfam:pKID 63 104 1.9e-20 PFAM
BRLZ 185 243 3.8e-6 SMART
Meta Mutation Damage Score 0.2113 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: This gene encodes a basic-leucine zipper domain-containing protein that localizes to gene promoters, where it binds to the cyclic AMP response element (CRE). Different protein isoforms encoded by this gene may function as either activators or repressors of transcription. Activity of this gene is important in multiple developmental processes, including spermatogenesis. Mutation of this gene causes male infertility. Alternative splicing and promoter usage result in multiple transcript variants for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygotes for targeted mutations exhibit reduced regenerative capacity after partial hepatectomy and reduced cardiac function. Males are sterile due to a block in spermiogenesis associated with a lack of postmeiotic gene expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Crem
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Crem APN 18 3299236 missense probably damaging 1.00
IGL01532:Crem APN 18 3276732 missense probably benign 0.02
IGL02500:Crem APN 18 3273477 missense probably damaging 1.00
IGL03280:Crem APN 18 3273415 splice site probably benign
menthe UTSW 18 3268070 missense probably damaging 1.00
R0987:Crem UTSW 18 3288060 missense probably damaging 0.98
R1829:Crem UTSW 18 3295037 splice site probably null
R1932:Crem UTSW 18 3299284 missense probably benign 0.27
R2086:Crem UTSW 18 3288098 intron probably benign
R2093:Crem UTSW 18 3299256 missense probably damaging 1.00
R4152:Crem UTSW 18 3288055 missense probably damaging 0.99
R4568:Crem UTSW 18 3299175 missense probably damaging 0.98
R4758:Crem UTSW 18 3327527 missense probably damaging 1.00
R6032:Crem UTSW 18 3267673 missense probably damaging 1.00
R6032:Crem UTSW 18 3267673 missense probably damaging 1.00
R6445:Crem UTSW 18 3309671 missense probably benign
R6525:Crem UTSW 18 3268070 missense probably damaging 1.00
R6651:Crem UTSW 18 3325428 missense probably benign 0.18
R7035:Crem UTSW 18 3327503 missense probably damaging 1.00
R7137:Crem UTSW 18 3273459 missense possibly damaging 0.89
R7401:Crem UTSW 18 3295329 missense probably damaging 1.00
R7463:Crem UTSW 18 3295094 missense probably benign 0.06
R7516:Crem UTSW 18 3299141 splice site probably null
R8095:Crem UTSW 18 3295106 missense probably benign 0.00
R8146:Crem UTSW 18 3288007 missense possibly damaging 0.68
R8266:Crem UTSW 18 3309535 intron probably benign
R8308:Crem UTSW 18 3295397 missense possibly damaging 0.55
Z1176:Crem UTSW 18 3267730 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ctgaggaggaggaaaaggtg -3'
Posted On2013-04-24