Incidental Mutation 'R3898:Zyg11a'
ID309045
Institutional Source Beutler Lab
Gene Symbol Zyg11a
Ensembl Gene ENSMUSG00000034645
Gene Namezyg-11 family member A, cell cycle regulator
Synonyms
MMRRC Submission 040906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R3898 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location108181738-108218048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108210194 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 40 (N40Y)
Ref Sequence ENSEMBL: ENSMUSP00000152477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043793] [ENSMUST00000106690] [ENSMUST00000223127]
Predicted Effect probably damaging
Transcript: ENSMUST00000043793
AA Change: N38Y

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038478
Gene: ENSMUSG00000034645
AA Change: N38Y

DomainStartEndE-ValueType
SCOP:d1jdha_ 218 700 2e-11 SMART
Blast:ARM 497 544 1e-5 BLAST
Blast:ARM 547 587 5e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106690
AA Change: N40Y

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102301
Gene: ENSMUSG00000034645
AA Change: N40Y

DomainStartEndE-ValueType
SCOP:d1jdha_ 139 621 1e-11 SMART
Blast:ARM 418 465 1e-5 BLAST
Blast:ARM 468 508 1e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000223127
AA Change: N40Y

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,593,102 V101A probably benign Het
Alg1 A C 16: 5,236,389 I154L possibly damaging Het
Ankra2 C T 13: 98,273,809 L136F probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Cabyr T C 18: 12,751,523 S356P probably benign Het
Cad G T 5: 31,074,022 C1633F probably benign Het
Cadps2 G A 6: 23,528,126 R425W probably damaging Het
Ccdc180 A G 4: 45,912,799 K593E possibly damaging Het
Cdh8 T A 8: 99,171,373 E436V probably damaging Het
Cln6 T G 9: 62,850,652 F231C probably damaging Het
Cul2 A G 18: 3,434,033 K677E probably benign Het
Cyp2c69 T C 19: 39,876,390 I215V probably benign Het
Dhx36 T C 3: 62,492,369 D393G probably damaging Het
Dnah7b T C 1: 46,243,257 V2850A probably damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drg2 T A 11: 60,456,634 S50T probably benign Het
Ecscr A G 18: 35,713,652 S230P possibly damaging Het
Eif2ak4 T C 2: 118,430,923 V527A probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Fli1 C T 9: 32,476,722 G24R possibly damaging Het
Frmd3 A G 4: 74,074,109 D71G probably damaging Het
Ggnbp1 A G 17: 27,025,338 probably benign Het
Gpat2 T C 2: 127,435,098 F713S probably damaging Het
H2-Q2 C T 17: 35,342,767 P78S probably damaging Het
Kcnq2 C T 2: 181,109,686 A306T probably damaging Het
Lmntd1 G A 6: 145,413,426 P333S probably benign Het
Lrp1 G A 10: 127,592,100 R535* probably null Het
Mmrn2 G T 14: 34,399,560 probably null Het
Nlrp1a G A 11: 71,122,874 P517S probably benign Het
Olfr1383 A T 11: 49,524,559 I279F probably damaging Het
Pou4f1 T C 14: 104,465,729 *422W probably null Het
Ptpn14 C T 1: 189,850,531 P525L probably benign Het
Pyroxd2 C A 19: 42,740,392 G190C probably damaging Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Sptbn5 T C 2: 120,057,210 noncoding transcript Het
Tbc1d5 A T 17: 50,963,744 F153Y probably damaging Het
Thop1 G A 10: 81,080,444 G429S probably damaging Het
Trim30d T A 7: 104,483,529 I184L probably benign Het
Ubr5 T C 15: 37,997,739 S1727G probably benign Het
Vezf1 T C 11: 88,076,173 F77L probably benign Het
Vmn2r12 C T 5: 109,090,504 A457T probably benign Het
Xirp1 A T 9: 120,019,340 M159K probably benign Het
Zkscan17 C T 11: 59,503,437 A113T probably damaging Het
Other mutations in Zyg11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Zyg11a APN 4 108204902 missense probably damaging 0.99
IGL01517:Zyg11a APN 4 108201194 missense probably null 1.00
IGL01619:Zyg11a APN 4 108205217 missense probably damaging 1.00
IGL02253:Zyg11a APN 4 108183695 missense probably null 0.99
R0090:Zyg11a UTSW 4 108201347 splice site probably benign
R0225:Zyg11a UTSW 4 108204641 missense probably damaging 1.00
R0610:Zyg11a UTSW 4 108204857 missense probably damaging 1.00
R0827:Zyg11a UTSW 4 108210042 splice site probably benign
R1568:Zyg11a UTSW 4 108183646 critical splice donor site probably null
R1752:Zyg11a UTSW 4 108205282 missense possibly damaging 0.81
R2051:Zyg11a UTSW 4 108192047 splice site probably benign
R2358:Zyg11a UTSW 4 108196146 missense possibly damaging 0.94
R4288:Zyg11a UTSW 4 108184469 missense probably damaging 1.00
R4381:Zyg11a UTSW 4 108201320 missense possibly damaging 0.58
R4709:Zyg11a UTSW 4 108205071 missense probably benign 0.00
R4859:Zyg11a UTSW 4 108210190 missense probably damaging 0.98
R5303:Zyg11a UTSW 4 108184432 critical splice donor site probably null
R5349:Zyg11a UTSW 4 108183732 missense probably damaging 1.00
R5363:Zyg11a UTSW 4 108189622 missense probably damaging 1.00
R5517:Zyg11a UTSW 4 108204746 missense possibly damaging 0.94
R6175:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R6254:Zyg11a UTSW 4 108181794 missense probably damaging 1.00
R6678:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R7524:Zyg11a UTSW 4 108192074 missense probably damaging 1.00
R7789:Zyg11a UTSW 4 108183648 missense probably damaging 1.00
R8022:Zyg11a UTSW 4 108189568 critical splice donor site probably null
X0061:Zyg11a UTSW 4 108193993 missense probably damaging 1.00
Z1176:Zyg11a UTSW 4 108201282 missense probably damaging 1.00
Z1177:Zyg11a UTSW 4 108204800 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTCTTCTGGGGTGTCTAAAGAC -3'
(R):5'- TCTCAAAGATAAACCCAGGCTTGC -3'

Sequencing Primer
(F):5'- TCTAAAGACAGCTACAGTGTACTTAC -3'
(R):5'- GATAAACCCAGGCTTGCAGGAC -3'
Posted On2015-04-17