Incidental Mutation 'R3898:Vmn2r12'
ID309047
Institutional Source Beutler Lab
Gene Symbol Vmn2r12
Ensembl Gene ENSMUSG00000090688
Gene Namevomeronasal 2, receptor 12
SynonymsGm6769
MMRRC Submission 040906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R3898 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location109085849-109097864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109090504 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 457 (A457T)
Ref Sequence ENSEMBL: ENSMUSP00000093612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095922]
Predicted Effect probably benign
Transcript: ENSMUST00000095922
AA Change: A457T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: A457T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.8e-30 PFAM
Pfam:NCD3G 505 559 1.7e-18 PFAM
Pfam:7tm_3 591 827 3.9e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,593,102 V101A probably benign Het
Alg1 A C 16: 5,236,389 I154L possibly damaging Het
Ankra2 C T 13: 98,273,809 L136F probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Cabyr T C 18: 12,751,523 S356P probably benign Het
Cad G T 5: 31,074,022 C1633F probably benign Het
Cadps2 G A 6: 23,528,126 R425W probably damaging Het
Ccdc180 A G 4: 45,912,799 K593E possibly damaging Het
Cdh8 T A 8: 99,171,373 E436V probably damaging Het
Cln6 T G 9: 62,850,652 F231C probably damaging Het
Cul2 A G 18: 3,434,033 K677E probably benign Het
Cyp2c69 T C 19: 39,876,390 I215V probably benign Het
Dhx36 T C 3: 62,492,369 D393G probably damaging Het
Dnah7b T C 1: 46,243,257 V2850A probably damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drg2 T A 11: 60,456,634 S50T probably benign Het
Ecscr A G 18: 35,713,652 S230P possibly damaging Het
Eif2ak4 T C 2: 118,430,923 V527A probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Fli1 C T 9: 32,476,722 G24R possibly damaging Het
Frmd3 A G 4: 74,074,109 D71G probably damaging Het
Ggnbp1 A G 17: 27,025,338 probably benign Het
Gpat2 T C 2: 127,435,098 F713S probably damaging Het
H2-Q2 C T 17: 35,342,767 P78S probably damaging Het
Kcnq2 C T 2: 181,109,686 A306T probably damaging Het
Lmntd1 G A 6: 145,413,426 P333S probably benign Het
Lrp1 G A 10: 127,592,100 R535* probably null Het
Mmrn2 G T 14: 34,399,560 probably null Het
Nlrp1a G A 11: 71,122,874 P517S probably benign Het
Olfr1383 A T 11: 49,524,559 I279F probably damaging Het
Pou4f1 T C 14: 104,465,729 *422W probably null Het
Ptpn14 C T 1: 189,850,531 P525L probably benign Het
Pyroxd2 C A 19: 42,740,392 G190C probably damaging Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Sptbn5 T C 2: 120,057,210 noncoding transcript Het
Tbc1d5 A T 17: 50,963,744 F153Y probably damaging Het
Thop1 G A 10: 81,080,444 G429S probably damaging Het
Trim30d T A 7: 104,483,529 I184L probably benign Het
Ubr5 T C 15: 37,997,739 S1727G probably benign Het
Vezf1 T C 11: 88,076,173 F77L probably benign Het
Xirp1 A T 9: 120,019,340 M159K probably benign Het
Zkscan17 C T 11: 59,503,437 A113T probably damaging Het
Zyg11a T A 4: 108,210,194 N40Y probably damaging Het
Other mutations in Vmn2r12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn2r12 APN 5 109097675 missense possibly damaging 0.47
IGL01096:Vmn2r12 APN 5 109086259 missense probably damaging 1.00
IGL01538:Vmn2r12 APN 5 109091850 missense probably damaging 1.00
IGL01548:Vmn2r12 APN 5 109093027 nonsense probably null
IGL01762:Vmn2r12 APN 5 109086564 missense probably damaging 0.99
IGL01860:Vmn2r12 APN 5 109092159 missense probably benign 0.10
IGL02269:Vmn2r12 APN 5 109086477 missense probably damaging 1.00
IGL02530:Vmn2r12 APN 5 109085992 missense probably damaging 1.00
IGL02887:Vmn2r12 APN 5 109090485 missense probably benign 0.03
IGL03265:Vmn2r12 APN 5 109092070 missense probably benign 0.05
R0396:Vmn2r12 UTSW 5 109092899 missense probably benign 0.00
R0497:Vmn2r12 UTSW 5 109091889 nonsense probably null
R0529:Vmn2r12 UTSW 5 109092848 missense probably benign
R0715:Vmn2r12 UTSW 5 109090507 missense probably benign 0.10
R0742:Vmn2r12 UTSW 5 109086415 missense possibly damaging 0.55
R0894:Vmn2r12 UTSW 5 109087850 critical splice donor site probably null
R1173:Vmn2r12 UTSW 5 109092854 missense probably benign 0.00
R1174:Vmn2r12 UTSW 5 109092854 missense probably benign 0.00
R1259:Vmn2r12 UTSW 5 109091897 missense probably damaging 0.97
R1349:Vmn2r12 UTSW 5 109086586 missense probably benign 0.00
R1388:Vmn2r12 UTSW 5 109092974 missense possibly damaging 0.56
R1549:Vmn2r12 UTSW 5 109092830 missense probably benign 0.06
R1766:Vmn2r12 UTSW 5 109092044 missense probably damaging 1.00
R1781:Vmn2r12 UTSW 5 109091728 missense probably benign 0.00
R1885:Vmn2r12 UTSW 5 109092076 missense probably damaging 1.00
R2159:Vmn2r12 UTSW 5 109091474 missense probably benign 0.02
R2420:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2421:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2422:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2937:Vmn2r12 UTSW 5 109091531 missense probably damaging 1.00
R2938:Vmn2r12 UTSW 5 109091531 missense probably damaging 1.00
R4061:Vmn2r12 UTSW 5 109092192 missense possibly damaging 0.95
R4063:Vmn2r12 UTSW 5 109092192 missense possibly damaging 0.95
R4090:Vmn2r12 UTSW 5 109091546 missense probably benign 0.06
R4297:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4298:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4299:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4304:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4306:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4307:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4308:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4594:Vmn2r12 UTSW 5 109086435 missense probably damaging 1.00
R4783:Vmn2r12 UTSW 5 109086513 missense probably damaging 1.00
R4900:Vmn2r12 UTSW 5 109092986 missense probably damaging 1.00
R4929:Vmn2r12 UTSW 5 109091678 missense probably damaging 1.00
R4974:Vmn2r12 UTSW 5 109091506 missense probably damaging 1.00
R5389:Vmn2r12 UTSW 5 109090395 missense probably benign 0.00
R5431:Vmn2r12 UTSW 5 109091818 missense probably damaging 0.99
R5527:Vmn2r12 UTSW 5 109086617 nonsense probably null
R5639:Vmn2r12 UTSW 5 109092800 missense probably benign 0.06
R5753:Vmn2r12 UTSW 5 109091804 missense probably damaging 1.00
R5797:Vmn2r12 UTSW 5 109085870 nonsense probably null
R6142:Vmn2r12 UTSW 5 109092897 missense probably benign
R6162:Vmn2r12 UTSW 5 109086564 missense probably damaging 0.99
R6176:Vmn2r12 UTSW 5 109086000 missense probably benign 0.43
R6853:Vmn2r12 UTSW 5 109092905 missense probably damaging 1.00
R7238:Vmn2r12 UTSW 5 109097789 missense possibly damaging 0.81
R7341:Vmn2r12 UTSW 5 109086247 missense possibly damaging 0.74
R7341:Vmn2r12 UTSW 5 109091945 missense possibly damaging 0.95
R7383:Vmn2r12 UTSW 5 109092818 missense probably benign 0.19
R7740:Vmn2r12 UTSW 5 109091749 missense probably damaging 1.00
R7749:Vmn2r12 UTSW 5 109086054 missense probably damaging 0.99
Z1088:Vmn2r12 UTSW 5 109092780 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGTAAGTATAGTCACAAGGAATC -3'
(R):5'- TTCTAGCACATTCTACCATGGAC -3'

Sequencing Primer
(F):5'- GGTCTTTGCTCCATATAACCAGAAGG -3'
(R):5'- CAGCTGTCTTTCTGAAATTCATTAAG -3'
Posted On2015-04-17