Incidental Mutation 'R0379:Ints5'
ID30906
Institutional Source Beutler Lab
Gene Symbol Ints5
Ensembl Gene ENSMUSG00000116347
Gene Name
Synonyms1110055N21Rik
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R0379 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8888926-8895227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8897133 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 819 (V819L)
Ref Sequence ENSEMBL: ENSMUSP00000093968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096246] [ENSMUST00000096249] [ENSMUST00000187504] [ENSMUST00000191089]
Predicted Effect probably benign
Transcript: ENSMUST00000096246
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000096249
AA Change: V819L

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093968
Gene: ENSMUSG00000071652
AA Change: V819L

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:INTS5_N 29 252 1e-82 PFAM
low complexity region 254 267 N/A INTRINSIC
Pfam:INTS5_C 289 998 2.2e-249 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187504
SMART Domains Protein: ENSMUSP00000139692
Gene: ENSMUSG00000096740

DomainStartEndE-ValueType
Pfam:Lbh 1 101 2.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188635
Predicted Effect probably benign
Transcript: ENSMUST00000191089
SMART Domains Protein: ENSMUSP00000140564
Gene: ENSMUSG00000116347

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Integrator complex is a complex that associates with the C-terminal domain of RNA polymerase II large subunit. This complex is brought to U1 and U2 small nuclear RNA genes, where it is involved in the transcription and processing of their transcripts. The protein encoded by this gene represents a subunit of the Integrator complex. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
March7 T C 2: 60,234,126 S249P probably benign Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in Ints5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ints5 APN 19 8895487 missense possibly damaging 0.93
IGL01915:Ints5 APN 19 8896993 missense probably benign
IGL01993:Ints5 APN 19 8895465 missense probably benign
IGL02264:Ints5 APN 19 8895712 missense probably benign 0.02
IGL02367:Ints5 APN 19 8895595 missense probably benign 0.06
IGL02955:Ints5 APN 19 8897650 missense probably damaging 1.00
FR4449:Ints5 UTSW 19 8897230 missense probably benign 0.10
R0348:Ints5 UTSW 19 8895750 missense probably damaging 0.97
R0617:Ints5 UTSW 19 8896019 missense probably damaging 1.00
R1954:Ints5 UTSW 19 8894896 missense probably damaging 1.00
R2172:Ints5 UTSW 19 8896282 missense possibly damaging 0.73
R2370:Ints5 UTSW 19 8896779 missense probably benign
R3116:Ints5 UTSW 19 8894772 missense possibly damaging 0.84
R4395:Ints5 UTSW 19 8896444 missense probably damaging 0.96
R5390:Ints5 UTSW 19 8896567 missense possibly damaging 0.73
R6868:Ints5 UTSW 19 8897386 missense probably damaging 1.00
R7133:Ints5 UTSW 19 8895559 missense probably damaging 1.00
R7685:Ints5 UTSW 19 8896804 missense probably benign 0.10
X0066:Ints5 UTSW 19 8896231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGGACATTAACCGGAGGCATAC -3'
(R):5'- TGACAGCCACCAGGATACAGGATG -3'

Sequencing Primer
(F):5'- GCCACCTAAAATTGTTCAATCTCG -3'
(R):5'- TTCCCAATGGCTCAAGAGG -3'
Posted On2013-04-24