Incidental Mutation 'R3898:Thop1'
ID309062
Institutional Source Beutler Lab
Gene Symbol Thop1
Ensembl Gene ENSMUSG00000004929
Gene Namethimet oligopeptidase 1
SynonymsEP24.15
MMRRC Submission 040906-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.593) question?
Stock #R3898 (G1)
Quality Score217
Status Not validated
Chromosome10
Chromosomal Location81070035-81082559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81080444 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 429 (G429S)
Ref Sequence ENSEMBL: ENSMUSP00000005057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005057] [ENSMUST00000117422]
Predicted Effect probably damaging
Transcript: ENSMUST00000005057
AA Change: G429S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005057
Gene: ENSMUSG00000004929
AA Change: G429S

DomainStartEndE-ValueType
Pfam:Peptidase_M3 227 677 7e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117422
SMART Domains Protein: ENSMUSP00000112836
Gene: ENSMUSG00000035041

DomainStartEndE-ValueType
low complexity region 179 199 N/A INTRINSIC
BRLZ 237 301 4.36e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171484
Meta Mutation Damage Score 0.6995 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kininase that uses zinc as a cofactor. The encoded oligopeptidase cleaves cytosolic peptides, making them unavailable for display on antigen-presenting cells. This protein also cleaves neuropeptides under 20 aa in length and can degrade beta-amyloid precursor protein to amyloidogenic peptides. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,593,102 V101A probably benign Het
Alg1 A C 16: 5,236,389 I154L possibly damaging Het
Ankra2 C T 13: 98,273,809 L136F probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Cabyr T C 18: 12,751,523 S356P probably benign Het
Cad G T 5: 31,074,022 C1633F probably benign Het
Cadps2 G A 6: 23,528,126 R425W probably damaging Het
Ccdc180 A G 4: 45,912,799 K593E possibly damaging Het
Cdh8 T A 8: 99,171,373 E436V probably damaging Het
Cln6 T G 9: 62,850,652 F231C probably damaging Het
Cul2 A G 18: 3,434,033 K677E probably benign Het
Cyp2c69 T C 19: 39,876,390 I215V probably benign Het
Dhx36 T C 3: 62,492,369 D393G probably damaging Het
Dnah7b T C 1: 46,243,257 V2850A probably damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drg2 T A 11: 60,456,634 S50T probably benign Het
Ecscr A G 18: 35,713,652 S230P possibly damaging Het
Eif2ak4 T C 2: 118,430,923 V527A probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Fli1 C T 9: 32,476,722 G24R possibly damaging Het
Frmd3 A G 4: 74,074,109 D71G probably damaging Het
Ggnbp1 A G 17: 27,025,338 probably benign Het
Gpat2 T C 2: 127,435,098 F713S probably damaging Het
H2-Q2 C T 17: 35,342,767 P78S probably damaging Het
Kcnq2 C T 2: 181,109,686 A306T probably damaging Het
Lmntd1 G A 6: 145,413,426 P333S probably benign Het
Lrp1 G A 10: 127,592,100 R535* probably null Het
Mmrn2 G T 14: 34,399,560 probably null Het
Nlrp1a G A 11: 71,122,874 P517S probably benign Het
Olfr1383 A T 11: 49,524,559 I279F probably damaging Het
Pou4f1 T C 14: 104,465,729 *422W probably null Het
Ptpn14 C T 1: 189,850,531 P525L probably benign Het
Pyroxd2 C A 19: 42,740,392 G190C probably damaging Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Sptbn5 T C 2: 120,057,210 noncoding transcript Het
Tbc1d5 A T 17: 50,963,744 F153Y probably damaging Het
Trim30d T A 7: 104,483,529 I184L probably benign Het
Ubr5 T C 15: 37,997,739 S1727G probably benign Het
Vezf1 T C 11: 88,076,173 F77L probably benign Het
Vmn2r12 C T 5: 109,090,504 A457T probably benign Het
Xirp1 A T 9: 120,019,340 M159K probably benign Het
Zkscan17 C T 11: 59,503,437 A113T probably damaging Het
Zyg11a T A 4: 108,210,194 N40Y probably damaging Het
Other mutations in Thop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Thop1 APN 10 81078599 nonsense probably null
IGL00987:Thop1 APN 10 81081695 missense probably damaging 0.99
R0241:Thop1 UTSW 10 81080245 unclassified probably benign
R0842:Thop1 UTSW 10 81075577 missense probably damaging 1.00
R1800:Thop1 UTSW 10 81073209 missense probably damaging 1.00
R1863:Thop1 UTSW 10 81073317 missense probably damaging 0.98
R2507:Thop1 UTSW 10 81070264 start codon destroyed probably null 0.47
R2905:Thop1 UTSW 10 81079591 missense probably damaging 1.00
R2930:Thop1 UTSW 10 81073314 missense probably damaging 0.98
R3899:Thop1 UTSW 10 81080444 missense probably damaging 1.00
R4911:Thop1 UTSW 10 81073291 missense probably damaging 1.00
R4924:Thop1 UTSW 10 81080194 missense probably benign 0.11
R4926:Thop1 UTSW 10 81073367 critical splice donor site probably null
R5092:Thop1 UTSW 10 81080578 missense probably damaging 1.00
R5968:Thop1 UTSW 10 81075559 missense probably benign 0.07
R6370:Thop1 UTSW 10 81077983 missense probably benign 0.00
R6733:Thop1 UTSW 10 81081412 missense probably damaging 0.98
R6853:Thop1 UTSW 10 81075661 critical splice donor site probably null
R7355:Thop1 UTSW 10 81075631 missense probably damaging 1.00
R7750:Thop1 UTSW 10 81080191 missense probably benign
R8030:Thop1 UTSW 10 81075616 missense possibly damaging 0.91
R8070:Thop1 UTSW 10 81079486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTATACCCCAGGTGAGAATG -3'
(R):5'- TGCCCTCACACCAAGTTAGC -3'

Sequencing Primer
(F):5'- TGAGAATGGGGCCCTGC -3'
(R):5'- GCTGGCGAGGAGTGATCTC -3'
Posted On2015-04-17