Mutagenetix > Incidental Mutations

Incidental Mutation 'R0379:Apba1'

30907

Institutional Source

Beutler Lab

Gene Symbol

Apba1

Ensembl Gene

ENSMUSG00000024897

Gene Name

amyloid beta (A4) precursor protein binding, family A, member 1

Synonyms

6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha

MMRRC Submission

038585-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0379 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23758876-23949597 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 23934830 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 558 (N558T)

Ref Sequence

ENSEMBL: ENSMUSP00000025830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025830]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025830
AA Change: N558T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: N558T

Domain	Start	End	E-Value	Type
low complexity region	40	47	N/A	INTRINSIC
low complexity region	59	74	N/A	INTRINSIC
low complexity region	129	149	N/A	INTRINSIC
low complexity region	404	421	N/A	INTRINSIC
PTB	461	626	9.49e-33	SMART
PDZ	670	748	3.09e-15	SMART
PDZ	762	828	2.53e-11	SMART

Meta Mutation Damage Score

0.5790

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.9%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,785,546		probably benign	Het
4930512M02Rik	A	G	11: 11,589,365		probably benign	Het
Arfgef2	T	A	2: 166,860,400		probably null	Het
Arsb	T	C	13: 93,940,627	S501P	probably benign	Het
Atp10b	A	G	11: 43,254,314	T1295A	probably benign	Het
Atp8b5	G	T	4: 43,361,898	R648L	probably damaging	Het
Bcl2a1b	T	C	9: 89,199,736	I126T	possibly damaging	Het
Brd9	T	C	13: 73,942,683		probably benign	Het
Cd93	T	C	2: 148,441,510		probably benign	Het
Chd5	A	G	4: 152,383,321	K1692R	probably benign	Het
Clcn4	T	C	7: 7,296,792	T13A	probably damaging	Het
Clec14a	A	G	12: 58,268,794	F14S	possibly damaging	Het
Clec4g	A	G	8: 3,718,440	V97A	probably benign	Het
Col24a1	G	A	3: 145,524,142	R1483K	possibly damaging	Het
Crem	A	T	18: 3,299,226	V82D	probably damaging	Het
Ctnna2	T	A	6: 77,641,440	T180S	probably benign	Het
Cybrd1	T	C	2: 71,129,755	I99T	probably benign	Het
Cyp4a32	G	A	4: 115,621,474	V468M	probably damaging	Het
Dlk1	A	G	12: 109,455,059		probably benign	Het
Dnah7b	A	T	1: 46,140,176	Y1003F	probably benign	Het
Egfem1	A	C	3: 29,668,250	E376A	possibly damaging	Het
Etl4	T	A	2: 20,807,354	I1416K	probably damaging	Het
Fbxl4	A	G	4: 22,386,106	T238A	probably benign	Het
Fer1l6	A	G	15: 58,548,338	I33M	probably benign	Het
Fndc3a	A	G	14: 72,556,609	S830P	probably damaging	Het
Fras1	C	T	5: 96,755,509	R3082*	probably null	Het
Galnt13	T	C	2: 55,060,492	V395A	possibly damaging	Het
Gm10334	T	G	6: 41,445,256		probably benign	Het
Gpd2	C	T	2: 57,345,263	T335I	probably damaging	Het
Gucy2d	C	A	7: 98,459,002		probably null	Het
Hydin	A	G	8: 110,509,127		probably benign	Het
Ints5	G	T	19: 8,897,133	V819L	possibly damaging	Het
Klhdc10	C	G	6: 30,450,670	Q292E	possibly damaging	Het
Lmbrd2	G	A	15: 9,149,479	A67T	probably benign	Het
Lrp1	T	G	10: 127,594,969	T404P	probably damaging	Het
March7	T	C	2: 60,234,126	S249P	probably benign	Het
Mcm10	T	A	2: 5,008,623	K66M	probably benign	Het
Mtmr7	C	A	8: 40,551,601	D645Y	probably damaging	Het
Muc6	T	A	7: 141,636,955	I2602F	possibly damaging	Het
Myh13	G	A	11: 67,369,295		probably benign	Het
Myo18a	G	A	11: 77,850,806	V1776I	possibly damaging	Het
Ncapg2	T	C	12: 116,443,075	L957S	probably damaging	Het
Ncoa3	T	C	2: 166,054,502	S442P	probably damaging	Het
Olfr1093	G	A	2: 86,785,735	E2K	probably benign	Het
Olfr850	T	A	9: 19,477,480	T257S	possibly damaging	Het
Olfr986	G	A	9: 40,187,433	G106D	probably damaging	Het
Pdcd6	G	T	13: 74,309,712	N113K	possibly damaging	Het
Pfkfb4	C	T	9: 109,027,742		probably benign	Het
Pfkm	A	G	15: 98,126,314	H401R	probably benign	Het
Phldb2	C	A	16: 45,781,451	D754Y	probably damaging	Het
Plekhb2	T	A	1: 34,863,114	M49K	probably damaging	Het
Polrmt	A	G	10: 79,737,611	S1057P	possibly damaging	Het
Prps1l1	A	G	12: 34,985,078	N64S	probably benign	Het
Psg16	T	C	7: 17,130,658	S393P	probably benign	Het
Rundc1	C	T	11: 101,425,147	T15I	probably benign	Het
Scaf11	A	G	15: 96,431,816	L143S	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Serpinf1	T	G	11: 75,413,945	I197L	probably benign	Het
Siglec1	C	T	2: 131,074,525		probably benign	Het
Slc28a1	G	A	7: 81,138,177	V271I	probably benign	Het
Sntg1	T	C	1: 8,782,824	D34G	probably damaging	Het
Sptbn4	A	T	7: 27,359,736		probably benign	Het
Suclg1	T	C	6: 73,256,228	I51T	possibly damaging	Het
Syne1	C	T	10: 5,541,989	R9Q	probably damaging	Het
Trim47	T	A	11: 116,106,518	H470L	probably damaging	Het
Ttc41	T	A	10: 86,712,977	Y12N	possibly damaging	Het
Tubgcp2	T	C	7: 140,032,192	E69G	probably damaging	Het
Tubgcp3	G	A	8: 12,641,116	T474M	probably damaging	Het
Ubr5	A	T	15: 38,018,957	N777K	probably benign	Het
Ush2a	T	C	1: 188,451,819	L1440P	probably damaging	Het
Usp28	A	C	9: 49,024,067	D458A	possibly damaging	Het
Vcan	A	T	13: 89,703,546	D1098E	probably damaging	Het
Vmn1r73	C	T	7: 11,756,846	T197I	probably benign	Het
Vmn2r15	T	C	5: 109,286,478	S787G	probably damaging	Het
Vmn2r90	T	A	17: 17,728,139	I549N	probably damaging	Het
Vps33b	T	A	7: 80,283,414		probably null	Het
Zfp516	A	T	18: 82,987,670	K900*	probably null	Het
Zfp974	T	A	7: 27,910,932	N456I	probably damaging	Het

Other mutations in Apba1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01475:Apba1	APN	19	23917586	missense	possibly damaging	0.95
IGL01991:Apba1	APN	19	23937472	missense	possibly damaging	0.80
IGL02048:Apba1	APN	19	23937636	splice site	probably null
IGL02522:Apba1	APN	19	23912445	splice site	probably benign
IGL02728:Apba1	APN	19	23944905	missense	possibly damaging	0.93
IGL02942:Apba1	APN	19	23944971	missense	possibly damaging	0.78
IGL03349:Apba1	APN	19	23917575	missense	probably benign	0.02
IGL03410:Apba1	APN	19	23937581	missense	possibly damaging	0.67
R0052:Apba1	UTSW	19	23915951	missense	possibly damaging	0.90
R0052:Apba1	UTSW	19	23915951	missense	possibly damaging	0.90
R0084:Apba1	UTSW	19	23912497	missense	possibly damaging	0.68
R0423:Apba1	UTSW	19	23944998	missense	probably damaging	1.00
R1132:Apba1	UTSW	19	23917553	missense	possibly damaging	0.83
R1291:Apba1	UTSW	19	23917672	missense	probably damaging	0.97
R1681:Apba1	UTSW	19	23936561	missense	probably damaging	1.00
R1714:Apba1	UTSW	19	23944952	missense	possibly damaging	0.67
R1756:Apba1	UTSW	19	23893692	missense	possibly damaging	0.83
R1866:Apba1	UTSW	19	23892831	missense	probably benign	0.22
R2076:Apba1	UTSW	19	23893223	nonsense	probably null
R2217:Apba1	UTSW	19	23893962	missense	probably damaging	0.99
R3907:Apba1	UTSW	19	23937506	missense	probably damaging	0.96
R4095:Apba1	UTSW	19	23944024	missense	probably benign	0.00
R4529:Apba1	UTSW	19	23936535	missense	probably damaging	1.00
R4557:Apba1	UTSW	19	23917592	missense	probably damaging	1.00
R4972:Apba1	UTSW	19	23912536	missense	probably benign	0.24
R5521:Apba1	UTSW	19	23893593	missense	probably damaging	1.00
R6539:Apba1	UTSW	19	23936560	missense	probably damaging	1.00
R7032:Apba1	UTSW	19	23912461	missense	probably benign	0.20
R7035:Apba1	UTSW	19	23917567	missense	possibly damaging	0.88
R7495:Apba1	UTSW	19	23936599	critical splice donor site	probably null
Z1176:Apba1	UTSW	19	23944115	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAACTCAAGGCTATGGTGGGC -3'
(R):5'- TGCTACTTAGTGGCTATCCAGGAGG -3'

Sequencing Primer
(F):5'- CTGGAGACTCTACACAGTGTAAAATG -3'
(R):5'- TATCCAGGAGGATAGGTTGGGG -3'

Posted On

2013-04-24