Incidental Mutation 'R3898:Pyroxd2'
ID309083
Institutional Source Beutler Lab
Gene Symbol Pyroxd2
Ensembl Gene ENSMUSG00000060224
Gene Namepyridine nucleotide-disulphide oxidoreductase domain 2
Synonyms
MMRRC Submission 040906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R3898 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location42725858-42752775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42740392 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 190 (G190C)
Ref Sequence ENSEMBL: ENSMUSP00000075825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076505]
Predicted Effect probably damaging
Transcript: ENSMUST00000076505
AA Change: G190C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075825
Gene: ENSMUSG00000060224
AA Change: G190C

DomainStartEndE-ValueType
Pfam:NAD_binding_8 39 97 3.5e-11 PFAM
Pfam:Amino_oxidase 46 423 2.7e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,593,102 V101A probably benign Het
Alg1 A C 16: 5,236,389 I154L possibly damaging Het
Ankra2 C T 13: 98,273,809 L136F probably benign Het
Anpep A G 7: 79,839,225 S372P probably benign Het
Cabyr T C 18: 12,751,523 S356P probably benign Het
Cad G T 5: 31,074,022 C1633F probably benign Het
Cadps2 G A 6: 23,528,126 R425W probably damaging Het
Ccdc180 A G 4: 45,912,799 K593E possibly damaging Het
Cdh8 T A 8: 99,171,373 E436V probably damaging Het
Cln6 T G 9: 62,850,652 F231C probably damaging Het
Cul2 A G 18: 3,434,033 K677E probably benign Het
Cyp2c69 T C 19: 39,876,390 I215V probably benign Het
Dhx36 T C 3: 62,492,369 D393G probably damaging Het
Dnah7b T C 1: 46,243,257 V2850A probably damaging Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drg2 T A 11: 60,456,634 S50T probably benign Het
Ecscr A G 18: 35,713,652 S230P possibly damaging Het
Eif2ak4 T C 2: 118,430,923 V527A probably damaging Het
Elfn1 G A 5: 139,971,964 R241H probably damaging Het
Fchsd2 A G 7: 101,191,799 K172E possibly damaging Het
Fli1 C T 9: 32,476,722 G24R possibly damaging Het
Frmd3 A G 4: 74,074,109 D71G probably damaging Het
Ggnbp1 A G 17: 27,025,338 probably benign Het
Gpat2 T C 2: 127,435,098 F713S probably damaging Het
H2-Q2 C T 17: 35,342,767 P78S probably damaging Het
Kcnq2 C T 2: 181,109,686 A306T probably damaging Het
Lmntd1 G A 6: 145,413,426 P333S probably benign Het
Lrp1 G A 10: 127,592,100 R535* probably null Het
Mmrn2 G T 14: 34,399,560 probably null Het
Nlrp1a G A 11: 71,122,874 P517S probably benign Het
Olfr1383 A T 11: 49,524,559 I279F probably damaging Het
Pou4f1 T C 14: 104,465,729 *422W probably null Het
Ptpn14 C T 1: 189,850,531 P525L probably benign Het
Rd3 T C 1: 191,985,256 V114A probably damaging Het
Sptbn5 T C 2: 120,057,210 noncoding transcript Het
Tbc1d5 A T 17: 50,963,744 F153Y probably damaging Het
Thop1 G A 10: 81,080,444 G429S probably damaging Het
Trim30d T A 7: 104,483,529 I184L probably benign Het
Ubr5 T C 15: 37,997,739 S1727G probably benign Het
Vezf1 T C 11: 88,076,173 F77L probably benign Het
Vmn2r12 C T 5: 109,090,504 A457T probably benign Het
Xirp1 A T 9: 120,019,340 M159K probably benign Het
Zkscan17 C T 11: 59,503,437 A113T probably damaging Het
Zyg11a T A 4: 108,210,194 N40Y probably damaging Het
Other mutations in Pyroxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Pyroxd2 APN 19 42731438 missense possibly damaging 0.89
IGL01636:Pyroxd2 APN 19 42738332 missense probably benign 0.40
IGL02808:Pyroxd2 APN 19 42731342 missense probably benign
IGL02831:Pyroxd2 APN 19 42735903 missense probably damaging 0.99
IGL03179:Pyroxd2 APN 19 42747562 missense possibly damaging 0.89
PIT4486001:Pyroxd2 UTSW 19 42740389 missense probably benign 0.00
R0360:Pyroxd2 UTSW 19 42747553 missense probably damaging 1.00
R0364:Pyroxd2 UTSW 19 42747553 missense probably damaging 1.00
R0567:Pyroxd2 UTSW 19 42735925 missense probably benign
R0690:Pyroxd2 UTSW 19 42727642 splice site probably benign
R0843:Pyroxd2 UTSW 19 42747547 missense probably damaging 1.00
R1649:Pyroxd2 UTSW 19 42738134 missense probably damaging 0.99
R2032:Pyroxd2 UTSW 19 42727649 splice site probably benign
R2087:Pyroxd2 UTSW 19 42733770 missense probably benign 0.00
R3040:Pyroxd2 UTSW 19 42735518 missense probably benign
R4746:Pyroxd2 UTSW 19 42752400 nonsense probably null
R5394:Pyroxd2 UTSW 19 42740459 missense probably benign
R5634:Pyroxd2 UTSW 19 42740485 missense probably benign 0.21
R5977:Pyroxd2 UTSW 19 42735472 missense probably damaging 1.00
R6745:Pyroxd2 UTSW 19 42747360 missense probably damaging 0.99
R7128:Pyroxd2 UTSW 19 42731403 missense probably benign 0.45
R7697:Pyroxd2 UTSW 19 42747366 missense probably benign
R7707:Pyroxd2 UTSW 19 42738147 missense probably damaging 0.98
R7769:Pyroxd2 UTSW 19 42747562 missense probably benign 0.00
R7878:Pyroxd2 UTSW 19 42742665 critical splice acceptor site probably null
R7961:Pyroxd2 UTSW 19 42742665 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTAAGCTGAACCTCTCCCTG -3'
(R):5'- CATATGGGAGTGTGGCACAG -3'

Sequencing Primer
(F):5'- AGAGTTCCTGGCAGCCTCTG -3'
(R):5'- GTGTGGCACAGAGGACC -3'
Posted On2015-04-17