Mutagenetix > Incidental Mutations

Incidental Mutation 'R3904:1110002E22Rik'

309094

Institutional Source

Beutler Lab

Gene Symbol

1110002E22Rik

Ensembl Gene

ENSMUSG00000090066

Gene Name

RIKEN cDNA 1110002E22 gene

Synonyms

MMRRC Submission

040812-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.519) question?

Stock #

R3904 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

138065052-138081506 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 138066639 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 530 (I530L)

Ref Sequence

ENSEMBL: ENSMUSP00000123851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053318

Predicted Effect

probably benign
Transcript: ENSMUST00000163080
AA Change: I530L

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: I530L

Domain	Start	End	E-Value	Type
low complexity region	44	55	N/A	INTRINSIC
low complexity region	87	102	N/A	INTRINSIC
low complexity region	229	247	N/A	INTRINSIC
low complexity region	422	438	N/A	INTRINSIC
low complexity region	459	505	N/A	INTRINSIC
low complexity region	667	680	N/A	INTRINSIC
low complexity region	937	948	N/A	INTRINSIC
low complexity region	995	1007	N/A	INTRINSIC
low complexity region	1105	1115	N/A	INTRINSIC
low complexity region	1224	1242	N/A	INTRINSIC
low complexity region	1376	1385	N/A	INTRINSIC
Pfam:DUF4585	1598	1667	6.9e-32	PFAM
low complexity region	1723	1738	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184925

Meta Mutation Damage Score

0.0617

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

100% (39/39)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5930422O12Rik	T	C	8: 33,429,439	S96P	probably damaging	Het
Acot4	A	G	12: 84,043,327		probably null	Het
Alms1	A	G	6: 85,621,678	D1631G	probably benign	Het
Amd1	C	T	10: 40,290,457	R210H	probably benign	Het
Amt	C	T	9: 108,297,221	R62C	possibly damaging	Het
Anapc1	A	G	2: 128,642,519	F1175S	probably damaging	Het
Ano4	A	G	10: 89,025,005	F337S	probably damaging	Het
Bub1	A	C	2: 127,821,942	I207S	probably benign	Het
Cfap53	T	A	18: 74,307,374	L405M	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col6a1	C	T	10: 76,711,341	R730H	unknown	Het
Esp3	A	T	17: 40,635,929	T48S	possibly damaging	Het
Fam35a	A	G	14: 34,259,709	W491R	probably damaging	Het
Fmo1	G	T	1: 162,833,768	N315K	possibly damaging	Het
Gm595	T	C	X: 48,841,544	N649S	possibly damaging	Het
Impg1	A	G	9: 80,345,585	S438P	possibly damaging	Het
Jsrp1	T	A	10: 80,812,412	M1L	probably benign	Het
Klra14-ps	T	A	6: 130,152,549		noncoding transcript	Het
Mrm3	A	G	11: 76,244,286	M108V	probably benign	Het
Mtf2	T	A	5: 108,081,000	F61I	probably damaging	Het
Nat10	A	T	2: 103,726,247		probably benign	Het
Olfr1356	T	G	10: 78,847,298	I206L	probably benign	Het
Olfr1380	T	C	11: 49,564,758	I279T	possibly damaging	Het
Pcgf5	T	C	19: 36,440,095	I140T	probably damaging	Het
Pfpl	T	C	19: 12,430,437	L684P	probably benign	Het
Psmd10	T	C	X: 140,949,303	*152W	probably null	Het
Ptpn23	A	C	9: 110,389,245	M600R	probably benign	Het
Pxmp4	C	T	2: 154,588,049	R140H	probably damaging	Het
Rnf112	T	C	11: 61,450,385	E410G	probably damaging	Het
Samd9l	T	A	6: 3,376,830	K144*	probably null	Het
Slc46a3	C	T	5: 147,886,454	E193K	probably benign	Het
Snap23	A	C	2: 120,599,334	D209A	possibly damaging	Het
Tg	C	T	15: 66,766,162	Q656*	probably null	Het
Tshz2	A	G	2: 169,884,387	Y301C	probably damaging	Het
Ttn	T	A	2: 76,840,294		probably benign	Het
Unc80	C	T	1: 66,639,296	Q2011*	probably null	Het
Vwa3a	A	G	7: 120,758,876	T57A	probably benign	Het
Zfp518a	C	T	19: 40,914,920	Q1098*	probably null	Het

Other mutations in 1110002E22Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0026:1110002E22Rik	UTSW	3	138066805	missense	possibly damaging	0.95
R0047:1110002E22Rik	UTSW	3	138066264	missense	probably damaging	0.97
R0047:1110002E22Rik	UTSW	3	138066264	missense	probably damaging	0.97
R0102:1110002E22Rik	UTSW	3	138068113	missense	probably damaging	1.00
R0102:1110002E22Rik	UTSW	3	138068113	missense	probably damaging	1.00
R0197:1110002E22Rik	UTSW	3	138069871	missense	probably damaging	1.00
R0239:1110002E22Rik	UTSW	3	138065834	small deletion	probably benign
R0394:1110002E22Rik	UTSW	3	138067304	missense	probably damaging	0.99
R0401:1110002E22Rik	UTSW	3	138070306	missense	possibly damaging	0.73
R0496:1110002E22Rik	UTSW	3	138068244	missense	probably damaging	1.00
R0591:1110002E22Rik	UTSW	3	138068943	nonsense	probably null
R0711:1110002E22Rik	UTSW	3	138068225	missense	probably damaging	0.99
R0883:1110002E22Rik	UTSW	3	138069871	missense	probably damaging	1.00
R0908:1110002E22Rik	UTSW	3	138070077	missense	probably damaging	0.99
R0968:1110002E22Rik	UTSW	3	138067206	missense	probably damaging	0.99
R1023:1110002E22Rik	UTSW	3	138066871	missense	probably damaging	1.00
R1168:1110002E22Rik	UTSW	3	138067900	missense	probably benign	0.20
R1472:1110002E22Rik	UTSW	3	138067552	missense	possibly damaging	0.95
R1538:1110002E22Rik	UTSW	3	138065401	missense	probably benign	0.02
R1648:1110002E22Rik	UTSW	3	138069420	missense	probably benign	0.18
R1800:1110002E22Rik	UTSW	3	138066718	missense	probably damaging	1.00
R1919:1110002E22Rik	UTSW	3	138067270	missense	probably damaging	0.99
R1974:1110002E22Rik	UTSW	3	138067267	missense	probably damaging	1.00
R1990:1110002E22Rik	UTSW	3	138065658	nonsense	probably null
R1991:1110002E22Rik	UTSW	3	138065658	nonsense	probably null
R2102:1110002E22Rik	UTSW	3	138065173	missense	probably damaging	0.99
R2761:1110002E22Rik	UTSW	3	138067780	missense	probably damaging	0.99
R2899:1110002E22Rik	UTSW	3	138065682	missense	probably benign	0.00
R3618:1110002E22Rik	UTSW	3	138068407	missense	probably damaging	1.00
R3955:1110002E22Rik	UTSW	3	138068073	missense	probably benign	0.00
R4520:1110002E22Rik	UTSW	3	138070266	missense	probably damaging	0.99
R4619:1110002E22Rik	UTSW	3	138069759	missense	probably damaging	0.99
R4736:1110002E22Rik	UTSW	3	138068485	missense	probably damaging	0.99
R4752:1110002E22Rik	UTSW	3	138069990	missense	possibly damaging	0.91
R4777:1110002E22Rik	UTSW	3	138065742	missense	probably benign	0.09
R4780:1110002E22Rik	UTSW	3	138065370	missense	probably benign	0.02
R4824:1110002E22Rik	UTSW	3	138065676	missense	probably benign	0.00
R4829:1110002E22Rik	UTSW	3	138069019	missense	probably damaging	0.99
R4965:1110002E22Rik	UTSW	3	138069672	missense	probably benign
R5206:1110002E22Rik	UTSW	3	138066511	missense	probably benign	0.00
R5212:1110002E22Rik	UTSW	3	138065850	missense	possibly damaging	0.85
R5373:1110002E22Rik	UTSW	3	138067635	missense	probably benign
R5374:1110002E22Rik	UTSW	3	138067635	missense	probably benign
R5506:1110002E22Rik	UTSW	3	138067947	missense	probably damaging	1.00
R5528:1110002E22Rik	UTSW	3	138066499	missense	probably benign
R5536:1110002E22Rik	UTSW	3	138066388	missense	possibly damaging	0.89
R5587:1110002E22Rik	UTSW	3	138065409	missense	probably benign
R5759:1110002E22Rik	UTSW	3	138068658	missense	probably benign
R5933:1110002E22Rik	UTSW	3	138070348	missense	probably damaging	1.00
R5957:1110002E22Rik	UTSW	3	138070161	missense	probably benign
R6092:1110002E22Rik	UTSW	3	138068940	missense	probably benign	0.02
R6305:1110002E22Rik	UTSW	3	138067980	missense	probably damaging	1.00
R6457:1110002E22Rik	UTSW	3	138066622	missense	probably damaging	1.00
R6469:1110002E22Rik	UTSW	3	138066975	missense	probably damaging	0.97
R6499:1110002E22Rik	UTSW	3	138068800	missense	probably damaging	1.00
R6527:1110002E22Rik	UTSW	3	138067527	missense	probably damaging	0.99
R6580:1110002E22Rik	UTSW	3	138066625	missense	probably benign	0.00
R6693:1110002E22Rik	UTSW	3	138069154	missense	probably benign	0.00
R6751:1110002E22Rik	UTSW	3	138066210	missense	probably damaging	1.00
R6852:1110002E22Rik	UTSW	3	138065169	nonsense	probably null
R6920:1110002E22Rik	UTSW	3	138068050	missense	probably damaging	1.00
R7001:1110002E22Rik	UTSW	3	138065511	missense	probably benign
R7145:1110002E22Rik	UTSW	3	138070059	missense	probably damaging	1.00
R7238:1110002E22Rik	UTSW	3	138069951	missense	probably damaging	1.00
R7278:1110002E22Rik	UTSW	3	138065476	missense	probably benign
R7425:1110002E22Rik	UTSW	3	138065695	missense	probably benign	0.00
R7487:1110002E22Rik	UTSW	3	138066868	missense	probably damaging	1.00
R7557:1110002E22Rik	UTSW	3	138068283	nonsense	probably null
R7663:1110002E22Rik	UTSW	3	138066126	missense	probably damaging	0.98
R7743:1110002E22Rik	UTSW	3	138068755	missense	probably damaging	1.00
R7799:1110002E22Rik	UTSW	3	138069601	missense	probably benign	0.33
R8181:1110002E22Rik	UTSW	3	138068395	missense	probably damaging	0.99
R8264:1110002E22Rik	UTSW	3	138067782	missense	probably damaging	0.99
R8273:1110002E22Rik	UTSW	3	138066450	missense	probably benign
R8434:1110002E22Rik	UTSW	3	138067260	missense	probably damaging	0.97
R8530:1110002E22Rik	UTSW	3	138068825	missense	probably damaging	0.99
R8754:1110002E22Rik	UTSW	3	138066037	missense	probably benign
R8808:1110002E22Rik	UTSW	3	138070113	missense	probably benign	0.01
R8891:1110002E22Rik	UTSW	3	138066759	nonsense	probably null
R9026:1110002E22Rik	UTSW	3	138065148	missense	possibly damaging	0.53
R9177:1110002E22Rik	UTSW	3	138069916	missense	probably damaging	1.00
R9250:1110002E22Rik	UTSW	3	138066628	missense	probably damaging	1.00
R9291:1110002E22Rik	UTSW	3	138066703	missense	probably benign	0.02
R9293:1110002E22Rik	UTSW	3	138066078	missense	possibly damaging	0.93
R9307:1110002E22Rik	UTSW	3	138065422	missense	probably benign	0.04
R9439:1110002E22Rik	UTSW	3	138066287	missense	probably benign	0.00
X0003:1110002E22Rik	UTSW	3	138069096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTACGCTTCCTTTGGTGG -3'
(R):5'- GTAGTCCACCAGCTCCTTTG -3'

Sequencing Primer
(F):5'- GATGACAATAGCTGTTACGTCAG -3'
(R):5'- AGCTCCTTTGCCCGGATG -3'

Posted On

2015-04-17