Incidental Mutation 'R3904:Mtf2'
ID309095
Institutional Source Beutler Lab
Gene Symbol Mtf2
Ensembl Gene ENSMUSG00000029267
Gene Namemetal response element binding transcription factor 2
SynonymsPcl2, C76717, 9230112N11Rik, M96
MMRRC Submission 040812-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R3904 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108065674-108109004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108081000 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 61 (F61I)
Ref Sequence ENSEMBL: ENSMUSP00000108245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081567] [ENSMUST00000112626] [ENSMUST00000124195] [ENSMUST00000134026] [ENSMUST00000143412] [ENSMUST00000170319] [ENSMUST00000172045]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081567
AA Change: F61I

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080278
Gene: ENSMUSG00000029267
AA Change: F61I

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
low complexity region 496 508 N/A INTRINSIC
Pfam:Mtf2_C 544 591 2.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112626
AA Change: F61I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108245
Gene: ENSMUSG00000029267
AA Change: F61I

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
low complexity region 439 451 N/A INTRINSIC
Pfam:Mtf2_C 485 535 5.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124195
AA Change: F61I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126297
Gene: ENSMUSG00000029267
AA Change: F61I

DomainStartEndE-ValueType
PDB:2EQJ|A 36 70 2e-17 PDB
Blast:TUDOR 44 75 7e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131291
Predicted Effect probably damaging
Transcript: ENSMUST00000134026
AA Change: F61I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128797
Gene: ENSMUSG00000029267
AA Change: F61I

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141592
Predicted Effect probably damaging
Transcript: ENSMUST00000143412
AA Change: F61I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132596
Gene: ENSMUSG00000029267
AA Change: F61I

DomainStartEndE-ValueType
TUDOR 44 101 1.22e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163823
Predicted Effect probably benign
Transcript: ENSMUST00000170319
SMART Domains Protein: ENSMUSP00000130536
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
PHD 1 37 6.4e-3 SMART
PHD 85 135 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172045
SMART Domains Protein: ENSMUSP00000126452
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
PHD 2 50 2.18e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198662
Meta Mutation Damage Score 0.5341 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit vertebral transformation and delayed replicative senescence in MEFs. Mice homozygous for one gene trap allele exhibit postnatal lethality, vertebral transformation and delayed replicative senescence in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,066,639 I530L probably benign Het
5930422O12Rik T C 8: 33,429,439 S96P probably damaging Het
Acot4 A G 12: 84,043,327 probably null Het
Alms1 A G 6: 85,621,678 D1631G probably benign Het
Amd1 C T 10: 40,290,457 R210H probably benign Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Anapc1 A G 2: 128,642,519 F1175S probably damaging Het
Ano4 A G 10: 89,025,005 F337S probably damaging Het
Bub1 A C 2: 127,821,942 I207S probably benign Het
Cfap53 T A 18: 74,307,374 L405M probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Esp3 A T 17: 40,635,929 T48S possibly damaging Het
Fam35a A G 14: 34,259,709 W491R probably damaging Het
Fmo1 G T 1: 162,833,768 N315K possibly damaging Het
Gm595 T C X: 48,841,544 N649S possibly damaging Het
Impg1 A G 9: 80,345,585 S438P possibly damaging Het
Jsrp1 T A 10: 80,812,412 M1L probably benign Het
Klra14-ps T A 6: 130,152,549 noncoding transcript Het
Mrm3 A G 11: 76,244,286 M108V probably benign Het
Nat10 A T 2: 103,726,247 probably benign Het
Olfr1356 T G 10: 78,847,298 I206L probably benign Het
Olfr1380 T C 11: 49,564,758 I279T possibly damaging Het
Pcgf5 T C 19: 36,440,095 I140T probably damaging Het
Pfpl T C 19: 12,430,437 L684P probably benign Het
Psmd10 T C X: 140,949,303 *152W probably null Het
Ptpn23 A C 9: 110,389,245 M600R probably benign Het
Pxmp4 C T 2: 154,588,049 R140H probably damaging Het
Rnf112 T C 11: 61,450,385 E410G probably damaging Het
Samd9l T A 6: 3,376,830 K144* probably null Het
Slc46a3 C T 5: 147,886,454 E193K probably benign Het
Snap23 A C 2: 120,599,334 D209A possibly damaging Het
Tg C T 15: 66,766,162 Q656* probably null Het
Tshz2 A G 2: 169,884,387 Y301C probably damaging Het
Ttn T A 2: 76,840,294 probably benign Het
Unc80 C T 1: 66,639,296 Q2011* probably null Het
Vwa3a A G 7: 120,758,876 T57A probably benign Het
Zfp518a C T 19: 40,914,920 Q1098* probably null Het
Other mutations in Mtf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Mtf2 APN 5 108106890 missense probably damaging 1.00
IGL01367:Mtf2 APN 5 108104457 missense probably benign 0.44
IGL01452:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01459:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01460:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01809:Mtf2 APN 5 108087325 missense probably benign 0.27
IGL03166:Mtf2 APN 5 108106720 missense probably benign 0.28
R0667:Mtf2 UTSW 5 108104503 missense probably damaging 1.00
R1533:Mtf2 UTSW 5 108092129 missense probably damaging 1.00
R1664:Mtf2 UTSW 5 108104476 missense probably damaging 1.00
R1723:Mtf2 UTSW 5 108088070 missense probably damaging 1.00
R2154:Mtf2 UTSW 5 108080931 missense possibly damaging 0.79
R2213:Mtf2 UTSW 5 108100914 missense possibly damaging 0.95
R4320:Mtf2 UTSW 5 108087025 missense probably damaging 1.00
R4560:Mtf2 UTSW 5 108086989 splice site probably null
R4764:Mtf2 UTSW 5 108093352 missense probably benign 0.43
R4989:Mtf2 UTSW 5 108073028 intron probably benign
R5305:Mtf2 UTSW 5 108104499 missense possibly damaging 0.84
R5356:Mtf2 UTSW 5 108106610 missense possibly damaging 0.92
R5528:Mtf2 UTSW 5 108094157 missense probably damaging 1.00
R6021:Mtf2 UTSW 5 108081137 missense possibly damaging 0.93
R7164:Mtf2 UTSW 5 108093369 missense possibly damaging 0.53
R7426:Mtf2 UTSW 5 108100970 missense probably benign
R7822:Mtf2 UTSW 5 108080877 nonsense probably null
Z1088:Mtf2 UTSW 5 108087329 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTTCCTGAACAGAGACTCTACAGG -3'
(R):5'- GATGTCCTTCCAGAGAACCCAG -3'

Sequencing Primer
(F):5'- CTCTACAGGAGCAGGTAATTCACTG -3'
(R):5'- TTCCAGAGAACCCAGGATTTG -3'
Posted On2015-04-17