Incidental Mutation 'R3904:Klra14-ps'
ID309100
Institutional Source Beutler Lab
Gene Symbol Klra14-ps
Ensembl Gene ENSMUSG00000072721
Gene Namekiller cell lectin-like receptor subfamily A, member 14, pseudogene
SynonymsEG654449, Ly49N, Gm15858, Klra14
MMRRC Submission 040812-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R3904 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location130149106-130160748 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 130152549 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203601
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,066,639 I530L probably benign Het
5930422O12Rik T C 8: 33,429,439 S96P probably damaging Het
Acot4 A G 12: 84,043,327 probably null Het
Alms1 A G 6: 85,621,678 D1631G probably benign Het
Amd1 C T 10: 40,290,457 R210H probably benign Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Anapc1 A G 2: 128,642,519 F1175S probably damaging Het
Ano4 A G 10: 89,025,005 F337S probably damaging Het
Bub1 A C 2: 127,821,942 I207S probably benign Het
Cfap53 T A 18: 74,307,374 L405M probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Esp3 A T 17: 40,635,929 T48S possibly damaging Het
Fam35a A G 14: 34,259,709 W491R probably damaging Het
Fmo1 G T 1: 162,833,768 N315K possibly damaging Het
Gm595 T C X: 48,841,544 N649S possibly damaging Het
Impg1 A G 9: 80,345,585 S438P possibly damaging Het
Jsrp1 T A 10: 80,812,412 M1L probably benign Het
Mrm3 A G 11: 76,244,286 M108V probably benign Het
Mtf2 T A 5: 108,081,000 F61I probably damaging Het
Nat10 A T 2: 103,726,247 probably benign Het
Olfr1356 T G 10: 78,847,298 I206L probably benign Het
Olfr1380 T C 11: 49,564,758 I279T possibly damaging Het
Pcgf5 T C 19: 36,440,095 I140T probably damaging Het
Pfpl T C 19: 12,430,437 L684P probably benign Het
Psmd10 T C X: 140,949,303 *152W probably null Het
Ptpn23 A C 9: 110,389,245 M600R probably benign Het
Pxmp4 C T 2: 154,588,049 R140H probably damaging Het
Rnf112 T C 11: 61,450,385 E410G probably damaging Het
Samd9l T A 6: 3,376,830 K144* probably null Het
Slc46a3 C T 5: 147,886,454 E193K probably benign Het
Snap23 A C 2: 120,599,334 D209A possibly damaging Het
Tg C T 15: 66,766,162 Q656* probably null Het
Tshz2 A G 2: 169,884,387 Y301C probably damaging Het
Ttn T A 2: 76,840,294 probably benign Het
Unc80 C T 1: 66,639,296 Q2011* probably null Het
Vwa3a A G 7: 120,758,876 T57A probably benign Het
Zfp518a C T 19: 40,914,920 Q1098* probably null Het
Other mutations in Klra14-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3917:Klra14-ps UTSW 6 130157632 splice site noncoding transcript
R4726:Klra14-ps UTSW 6 130157663 exon noncoding transcript
R5215:Klra14-ps UTSW 6 130157683 exon noncoding transcript
R5708:Klra14-ps UTSW 6 130157788 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GTAAAGAAAAGCCTTTGCAGACAAC -3'
(R):5'- TCATGAACCGAGGACACTTGAAG -3'

Sequencing Primer
(F):5'- TTTGCAGACAACCCTCTCAATC -3'
(R):5'- TGAATATGATGAGACTGAGTG -3'
Posted On2015-04-17