Mutagenetix > Incidental Mutation

Incidental Mutation 'R3904:Rnf112'

309112

Institutional Source

Beutler Lab

Gene Symbol

Rnf112

Ensembl Gene

ENSMUSG00000010086

Gene Name

ring finger protein 112

Synonyms

Zfp179, bfp

MMRRC Submission

040812-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3904 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61448442-61454131 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61450385 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 410 (E410G)

Ref Sequence

ENSEMBL: ENSMUSP00000099722 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054927] [ENSMUST00000060255] [ENSMUST00000102661]

AlphaFold

Q96DY5

Predicted Effect

probably damaging
Transcript: ENSMUST00000054927
AA Change: E433G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056464
Gene: ENSMUSG00000010086
AA Change: E433G

Domain	Start	End	E-Value	Type
RING	80	120	3.78e-5	SMART
low complexity region	139	150	N/A	INTRINSIC
Pfam:GBP	171	423	1.3e-21	PFAM
low complexity region	541	557	N/A	INTRINSIC
transmembrane domain	570	592	N/A	INTRINSIC
transmembrane domain	605	627	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000060255
AA Change: E458G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000059903
Gene: ENSMUSG00000010086
AA Change: E458G

Domain	Start	End	E-Value	Type
RING	80	120	3.78e-5	SMART
low complexity region	139	150	N/A	INTRINSIC
Pfam:GBP	171	448	2.8e-21	PFAM
low complexity region	566	582	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
transmembrane domain	630	652	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102661
AA Change: E410G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099722
Gene: ENSMUSG00000010086
AA Change: E410G

Domain	Start	End	E-Value	Type
RING	57	97	1.7e-7	SMART
low complexity region	116	127	N/A	INTRINSIC
Pfam:GBP	148	400	2.7e-19	PFAM
low complexity region	518	534	N/A	INTRINSIC
transmembrane domain	547	569	N/A	INTRINSIC
transmembrane domain	582	604	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126859

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130648

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136966

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152137

Meta Mutation Damage Score

0.0960

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING finger protein family of transcription factors. The protein is primarily expressed in brain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced dendritic spines, functional synapses and paired pulse facilitation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	C	3: 138,066,639	I530L	probably benign	Het
5930422O12Rik	T	C	8: 33,429,439	S96P	probably damaging	Het
Acot4	A	G	12: 84,043,327		probably null	Het
Alms1	A	G	6: 85,621,678	D1631G	probably benign	Het
Amd1	C	T	10: 40,290,457	R210H	probably benign	Het
Amt	C	T	9: 108,297,221	R62C	possibly damaging	Het
Anapc1	A	G	2: 128,642,519	F1175S	probably damaging	Het
Ano4	A	G	10: 89,025,005	F337S	probably damaging	Het
Bub1	A	C	2: 127,821,942	I207S	probably benign	Het
Cfap53	T	A	18: 74,307,374	L405M	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col6a1	C	T	10: 76,711,341	R730H	unknown	Het
Esp3	A	T	17: 40,635,929	T48S	possibly damaging	Het
Fam35a	A	G	14: 34,259,709	W491R	probably damaging	Het
Fmo1	G	T	1: 162,833,768	N315K	possibly damaging	Het
Gm595	T	C	X: 48,841,544	N649S	possibly damaging	Het
Impg1	A	G	9: 80,345,585	S438P	possibly damaging	Het
Jsrp1	T	A	10: 80,812,412	M1L	probably benign	Het
Klra14-ps	T	A	6: 130,152,549		noncoding transcript	Het
Mrm3	A	G	11: 76,244,286	M108V	probably benign	Het
Mtf2	T	A	5: 108,081,000	F61I	probably damaging	Het
Nat10	A	T	2: 103,726,247		probably benign	Het
Olfr1356	T	G	10: 78,847,298	I206L	probably benign	Het
Olfr1380	T	C	11: 49,564,758	I279T	possibly damaging	Het
Pcgf5	T	C	19: 36,440,095	I140T	probably damaging	Het
Pfpl	T	C	19: 12,430,437	L684P	probably benign	Het
Psmd10	T	C	X: 140,949,303	*152W	probably null	Het
Ptpn23	A	C	9: 110,389,245	M600R	probably benign	Het
Pxmp4	C	T	2: 154,588,049	R140H	probably damaging	Het
Samd9l	T	A	6: 3,376,830	K144*	probably null	Het
Slc46a3	C	T	5: 147,886,454	E193K	probably benign	Het
Snap23	A	C	2: 120,599,334	D209A	possibly damaging	Het
Tg	C	T	15: 66,766,162	Q656*	probably null	Het
Tshz2	A	G	2: 169,884,387	Y301C	probably damaging	Het
Ttn	T	A	2: 76,840,294		probably benign	Het
Unc80	C	T	1: 66,639,296	Q2011*	probably null	Het
Vwa3a	A	G	7: 120,758,876	T57A	probably benign	Het
Zfp518a	C	T	19: 40,914,920	Q1098*	probably null	Het

Other mutations in Rnf112

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Rnf112	APN	11	61452784	missense	probably damaging	1.00
IGL01339:Rnf112	APN	11	61450477	missense	probably benign	0.00
IGL01469:Rnf112	APN	11	61451341	missense	possibly damaging	0.94
IGL02102:Rnf112	APN	11	61452015	missense	probably benign	0.36
IGL02216:Rnf112	APN	11	61449978	missense	probably damaging	1.00
IGL02431:Rnf112	APN	11	61450379	missense	probably benign	0.17
IGL02638:Rnf112	APN	11	61449405	utr 3 prime	probably benign
IGL02657:Rnf112	APN	11	61450252	splice site	probably null
R0041:Rnf112	UTSW	11	61452355	missense	probably damaging	1.00
R1514:Rnf112	UTSW	11	61450410	missense	probably benign	0.01
R1991:Rnf112	UTSW	11	61452426	missense	probably damaging	1.00
R2119:Rnf112	UTSW	11	61451028	missense	possibly damaging	0.92
R2216:Rnf112	UTSW	11	61452279	missense	probably damaging	1.00
R2880:Rnf112	UTSW	11	61450467	missense	possibly damaging	0.89
R3775:Rnf112	UTSW	11	61450185	splice site	probably benign
R4646:Rnf112	UTSW	11	61452110	missense	probably damaging	0.99
R4710:Rnf112	UTSW	11	61449831	missense	probably damaging	1.00
R4860:Rnf112	UTSW	11	61452744	missense	possibly damaging	0.67
R4860:Rnf112	UTSW	11	61452744	missense	possibly damaging	0.67
R4894:Rnf112	UTSW	11	61452662	missense	probably damaging	1.00
R4930:Rnf112	UTSW	11	61453465	missense	probably benign
R4967:Rnf112	UTSW	11	61452926	splice site	probably benign
R4992:Rnf112	UTSW	11	61452711	missense	possibly damaging	0.72
R5547:Rnf112	UTSW	11	61451028	missense	possibly damaging	0.92
R5874:Rnf112	UTSW	11	61449447	missense	probably damaging	0.98
R5997:Rnf112	UTSW	11	61451022	missense	possibly damaging	0.87
R6023:Rnf112	UTSW	11	61449729	missense	probably damaging	1.00
R6906:Rnf112	UTSW	11	61450389	missense	probably null	0.38
R7194:Rnf112	UTSW	11	61450857	missense	probably damaging	1.00
R7439:Rnf112	UTSW	11	61451028	missense	possibly damaging	0.92
R7984:Rnf112	UTSW	11	61449480	missense	possibly damaging	0.79
R8984:Rnf112	UTSW	11	61452451	missense	possibly damaging	0.90
R9756:Rnf112	UTSW	11	61449841	missense	probably damaging	1.00
Z1177:Rnf112	UTSW	11	61449679	missense	probably damaging	1.00
Z1186:Rnf112	UTSW	11	61450949	missense	unknown
Z1187:Rnf112	UTSW	11	61450949	missense	unknown
Z1188:Rnf112	UTSW	11	61450949	missense	unknown
Z1189:Rnf112	UTSW	11	61450949	missense	unknown
Z1190:Rnf112	UTSW	11	61450949	missense	unknown
Z1191:Rnf112	UTSW	11	61450949	missense	unknown
Z1192:Rnf112	UTSW	11	61450949	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCATCAGGAGAGTTGAAACTGG -3'
(R):5'- CAGAGGCAGTAAGTGTTCCAGG -3'

Sequencing Primer
(F):5'- GGGCCCAGTCTTCCCCATC -3'
(R):5'- TGGAGACTTCCCTGGCATG -3'

Posted On

2015-04-17