Incidental Mutation 'R3904:Pcgf5'
ID309120
Institutional Source Beutler Lab
Gene Symbol Pcgf5
Ensembl Gene ENSMUSG00000024805
Gene Namepolycomb group ring finger 5
Synonyms0610009F02Rik, 5830443C21Rik, 5830406C17Rik, 1110054A01Rik, 9530023M17Rik
MMRRC Submission 040812-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.728) question?
Stock #R3904 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location36348309-36460970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36440095 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 140 (I140T)
Ref Sequence ENSEMBL: ENSMUSP00000153066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062389] [ENSMUST00000071267] [ENSMUST00000224679] [ENSMUST00000224772] [ENSMUST00000224971] [ENSMUST00000225411] [ENSMUST00000225920]
Predicted Effect probably damaging
Transcript: ENSMUST00000062389
AA Change: I141T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058730
Gene: ENSMUSG00000024805
AA Change: I141T

DomainStartEndE-ValueType
RING 18 56 4.05e-5 SMART
low complexity region 86 96 N/A INTRINSIC
Pfam:RAWUL 146 230 2.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071267
AA Change: I141T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071245
Gene: ENSMUSG00000024805
AA Change: I141T

DomainStartEndE-ValueType
RING 18 56 4.05e-5 SMART
low complexity region 86 96 N/A INTRINSIC
Pfam:RAWUL 146 230 2.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224679
AA Change: I141T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000224772
AA Change: I140T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000224859
AA Change: I66T
Predicted Effect probably benign
Transcript: ENSMUST00000224971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225185
Predicted Effect probably damaging
Transcript: ENSMUST00000225411
AA Change: I141T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000225920
AA Change: I141T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.3304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Bone marrow cells from mice homozygous for a conditional allele exhibit normal hematopoietic and progenitor cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,066,639 I530L probably benign Het
5930422O12Rik T C 8: 33,429,439 S96P probably damaging Het
Acot4 A G 12: 84,043,327 probably null Het
Alms1 A G 6: 85,621,678 D1631G probably benign Het
Amd1 C T 10: 40,290,457 R210H probably benign Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Anapc1 A G 2: 128,642,519 F1175S probably damaging Het
Ano4 A G 10: 89,025,005 F337S probably damaging Het
Bub1 A C 2: 127,821,942 I207S probably benign Het
Cfap53 T A 18: 74,307,374 L405M probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Esp3 A T 17: 40,635,929 T48S possibly damaging Het
Fam35a A G 14: 34,259,709 W491R probably damaging Het
Fmo1 G T 1: 162,833,768 N315K possibly damaging Het
Gm595 T C X: 48,841,544 N649S possibly damaging Het
Impg1 A G 9: 80,345,585 S438P possibly damaging Het
Jsrp1 T A 10: 80,812,412 M1L probably benign Het
Klra14-ps T A 6: 130,152,549 noncoding transcript Het
Mrm3 A G 11: 76,244,286 M108V probably benign Het
Mtf2 T A 5: 108,081,000 F61I probably damaging Het
Nat10 A T 2: 103,726,247 probably benign Het
Olfr1356 T G 10: 78,847,298 I206L probably benign Het
Olfr1380 T C 11: 49,564,758 I279T possibly damaging Het
Pfpl T C 19: 12,430,437 L684P probably benign Het
Psmd10 T C X: 140,949,303 *152W probably null Het
Ptpn23 A C 9: 110,389,245 M600R probably benign Het
Pxmp4 C T 2: 154,588,049 R140H probably damaging Het
Rnf112 T C 11: 61,450,385 E410G probably damaging Het
Samd9l T A 6: 3,376,830 K144* probably null Het
Slc46a3 C T 5: 147,886,454 E193K probably benign Het
Snap23 A C 2: 120,599,334 D209A possibly damaging Het
Tg C T 15: 66,766,162 Q656* probably null Het
Tshz2 A G 2: 169,884,387 Y301C probably damaging Het
Ttn T A 2: 76,840,294 probably benign Het
Unc80 C T 1: 66,639,296 Q2011* probably null Het
Vwa3a A G 7: 120,758,876 T57A probably benign Het
Zfp518a C T 19: 40,914,920 Q1098* probably null Het
Other mutations in Pcgf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Pcgf5 APN 19 36442868 missense probably damaging 1.00
IGL03184:Pcgf5 APN 19 36434676 splice site probably benign
IGL03259:Pcgf5 APN 19 36455659 missense probably benign 0.28
whalebone UTSW 19 36442939 nonsense probably null
R0318:Pcgf5 UTSW 19 36412190 missense possibly damaging 0.81
R0570:Pcgf5 UTSW 19 36412180 missense probably benign 0.00
R0890:Pcgf5 UTSW 19 36412144 missense probably benign 0.05
R2238:Pcgf5 UTSW 19 36437354 missense probably damaging 0.97
R2239:Pcgf5 UTSW 19 36437354 missense probably damaging 0.97
R4050:Pcgf5 UTSW 19 36442911 missense probably damaging 0.99
R4209:Pcgf5 UTSW 19 36437340 missense possibly damaging 0.81
R4210:Pcgf5 UTSW 19 36437340 missense possibly damaging 0.81
R4211:Pcgf5 UTSW 19 36437340 missense possibly damaging 0.81
R5202:Pcgf5 UTSW 19 36437183 missense probably damaging 1.00
R5997:Pcgf5 UTSW 19 36434603 missense probably benign 0.35
R6039:Pcgf5 UTSW 19 36442906 missense probably damaging 1.00
R6039:Pcgf5 UTSW 19 36442906 missense probably damaging 1.00
R7060:Pcgf5 UTSW 19 36442939 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTCAGTCTTCAGAGAGGTTATG -3'
(R):5'- ACTAGATGGTGGCACTGGTC -3'

Sequencing Primer
(F):5'- ATGAAATATTTTAGGTTGGTCATTGC -3'
(R):5'- CACTGGTCTGGGAGAACTG -3'
Posted On2015-04-17