Incidental Mutation 'R3905:Mark1'
ID309129
Institutional Source Beutler Lab
Gene Symbol Mark1
Ensembl Gene ENSMUSG00000026620
Gene NameMAP/microtubule affinity regulating kinase 1
SynonymsEmk3, B930025N23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R3905 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location184896789-184999570 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 184908435 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027929]
Predicted Effect probably null
Transcript: ENSMUST00000027929
SMART Domains Protein: ENSMUSP00000027929
Gene: ENSMUSG00000026620

DomainStartEndE-ValueType
S_TKc 60 311 1.12e-108 SMART
low complexity region 316 328 N/A INTRINSIC
UBA 332 369 4.56e-9 SMART
low complexity region 376 386 N/A INTRINSIC
low complexity region 523 547 N/A INTRINSIC
low complexity region 585 599 N/A INTRINSIC
Pfam:KA1 751 795 4.5e-23 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Mark1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mark1 APN 1 184898603 missense probably damaging 1.00
IGL00674:Mark1 APN 1 184912106 missense probably benign
IGL01903:Mark1 APN 1 184929380 splice site probably benign
IGL02004:Mark1 APN 1 184912589 missense possibly damaging 0.82
IGL03177:Mark1 APN 1 184944907 missense probably damaging 1.00
IGL03189:Mark1 APN 1 184919693 missense probably damaging 0.96
IGL03391:Mark1 APN 1 184919435 unclassified probably benign
R0277:Mark1 UTSW 1 184944952 missense possibly damaging 0.89
R0744:Mark1 UTSW 1 184921608 missense probably damaging 1.00
R0973:Mark1 UTSW 1 184921604 missense probably damaging 1.00
R1331:Mark1 UTSW 1 184928048 missense probably damaging 1.00
R2061:Mark1 UTSW 1 184928063 missense probably damaging 1.00
R2136:Mark1 UTSW 1 184919573 missense probably damaging 1.00
R2306:Mark1 UTSW 1 184900861 splice site probably benign
R3159:Mark1 UTSW 1 184908387 missense probably damaging 1.00
R4321:Mark1 UTSW 1 184898674 missense possibly damaging 0.46
R4512:Mark1 UTSW 1 184907089 missense probably benign 0.21
R4715:Mark1 UTSW 1 184912132 missense probably benign 0.00
R4829:Mark1 UTSW 1 184905527 missense possibly damaging 0.82
R5163:Mark1 UTSW 1 184905610 missense probably damaging 0.98
R5222:Mark1 UTSW 1 184928091 missense probably damaging 1.00
R5680:Mark1 UTSW 1 184944816 missense probably damaging 1.00
R6582:Mark1 UTSW 1 184912589 missense possibly damaging 0.82
R6943:Mark1 UTSW 1 184898787 missense probably damaging 1.00
R6979:Mark1 UTSW 1 184912628 missense possibly damaging 0.77
R7031:Mark1 UTSW 1 184912632 missense possibly damaging 0.82
R7455:Mark1 UTSW 1 184919750 missense probably damaging 0.99
R7470:Mark1 UTSW 1 184928044 nonsense probably null
R7715:Mark1 UTSW 1 184907234 missense probably damaging 0.98
R8193:Mark1 UTSW 1 184928052 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTATGGACATTTCAGCAAAGC -3'
(R):5'- GTGAATTGGCTCATGCTTTCTC -3'

Sequencing Primer
(F):5'- TGGACATTTCAGCAAAGCTAACATGC -3'
(R):5'- GGCTCATGCTTTCTCTTGGTTTCG -3'
Posted On2015-04-17