Incidental Mutation 'R3905:Ap4b1'
ID309133
Institutional Source Beutler Lab
Gene Symbol Ap4b1
Ensembl Gene ENSMUSG00000032952
Gene Nameadaptor-related protein complex AP-4, beta 1
SynonymsAP-4 beta-4, 1810038H16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R3905 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103809520-103822025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103818893 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 262 (I262F)
Ref Sequence ENSEMBL: ENSMUSP00000143355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047285] [ENSMUST00000076599] [ENSMUST00000106823] [ENSMUST00000106824] [ENSMUST00000199710] [ENSMUST00000200377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047285
AA Change: I430F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044262
Gene: ENSMUSG00000032952
AA Change: I430F

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 7e-94 PFAM
Pfam:Cnd1 98 269 2.4e-11 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000076599
AA Change: I430F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075904
Gene: ENSMUSG00000032952
AA Change: I430F

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 1e-93 PFAM
Pfam:Cnd1 98 286 3.9e-10 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106823
AA Change: I402F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102436
Gene: ENSMUSG00000032952
AA Change: I402F

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 374 2e-68 PFAM
Pfam:Cnd1 98 285 1.4e-10 PFAM
Pfam:Adaptin_N 371 497 5.2e-16 PFAM
B2-adapt-app_C 591 703 3.75e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106824
AA Change: I355F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102437
Gene: ENSMUSG00000032952
AA Change: I355F

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199686
Predicted Effect possibly damaging
Transcript: ENSMUST00000199710
AA Change: I355F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143463
Gene: ENSMUSG00000105053
AA Change: I355F

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199723
Predicted Effect possibly damaging
Transcript: ENSMUST00000200377
AA Change: I262F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143355
Gene: ENSMUSG00000032952
AA Change: I262F

DomainStartEndE-ValueType
Pfam:Adaptin_N 7 357 2.9e-45 PFAM
B2-adapt-app_C 451 563 2.8e-46 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a heterotetrameric adapter-like complex 4 that is involved in targeting proteins from the trans-Golgi network to the endosomal-lysosomal system. Mutations in this gene are associated with cerebral palsy spastic quadriplegic type 5 (CPSQ5) disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit poor rotarod performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Ap4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ap4b1 APN 3 103821542 missense probably benign 0.19
IGL01545:Ap4b1 APN 3 103812827 missense probably benign 0.02
IGL02422:Ap4b1 APN 3 103812854 missense possibly damaging 0.95
IGL02525:Ap4b1 APN 3 103812848 missense probably damaging 1.00
R0035:Ap4b1 UTSW 3 103820664 splice site probably benign
R0035:Ap4b1 UTSW 3 103820664 splice site probably benign
R0086:Ap4b1 UTSW 3 103814860 missense probably damaging 0.99
R0090:Ap4b1 UTSW 3 103820429 missense possibly damaging 0.91
R0136:Ap4b1 UTSW 3 103809946 start codon destroyed probably null 1.00
R0299:Ap4b1 UTSW 3 103809946 start codon destroyed probably null 1.00
R0403:Ap4b1 UTSW 3 103818839 missense probably damaging 0.99
R0403:Ap4b1 UTSW 3 103821396 missense probably benign 0.00
R1283:Ap4b1 UTSW 3 103818861 missense probably damaging 1.00
R1673:Ap4b1 UTSW 3 103817845 critical splice donor site probably null
R1797:Ap4b1 UTSW 3 103818833 missense possibly damaging 0.92
R1869:Ap4b1 UTSW 3 103820868 nonsense probably null
R2925:Ap4b1 UTSW 3 103820681 missense probably damaging 1.00
R4079:Ap4b1 UTSW 3 103813378 missense probably damaging 1.00
R4645:Ap4b1 UTSW 3 103821449 missense probably benign 0.32
R4786:Ap4b1 UTSW 3 103818804 missense probably benign 0.00
R5824:Ap4b1 UTSW 3 103813385 missense probably benign 0.30
R6342:Ap4b1 UTSW 3 103813368 missense possibly damaging 0.60
R6826:Ap4b1 UTSW 3 103812908 critical splice donor site probably null
R6923:Ap4b1 UTSW 3 103812214 missense probably benign 0.19
R6974:Ap4b1 UTSW 3 103813285 nonsense probably null
R7409:Ap4b1 UTSW 3 103812158 missense probably damaging 0.98
R7827:Ap4b1 UTSW 3 103815082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATTAGTCCATGTCCACAGC -3'
(R):5'- TGAGGCATAAGCACACCTGAG -3'

Sequencing Primer
(F):5'- GTGTGTAAAATTCAAGTGTATTGCCC -3'
(R):5'- AATTAGGTTCCATTTCAGGGCTAGAG -3'
Posted On2015-04-17