Mutagenetix > Incidental Mutation

Incidental Mutation 'R3905:Cfap57'

309135

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3905 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118595839 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 556 (Y556H)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

AlphaFold

Q9D180

Predicted Effect

probably damaging
Transcript: ENSMUST00000071972
AA Change: Y556H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: Y556H

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000081921
AA Change: Y556H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: Y556H

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	T	1: 71,268,230	I1964N	possibly damaging	Het
Abca12	A	G	1: 71,279,457	F1796L	probably benign	Het
Abca17	T	A	17: 24,296,283	M821L	probably benign	Het
Adamts3	C	A	5: 89,861,355	G150C	probably damaging	Het
Ap4b1	A	T	3: 103,818,893	I262F	possibly damaging	Het
Atp1a1	T	A	3: 101,590,612	E286D	probably benign	Het
Bard1	T	C	1: 71,067,180	I429M	possibly damaging	Het
Bcl7c	T	C	7: 127,666,983	R198G	possibly damaging	Het
Cacna1s	T	A	1: 136,084,269	M483K	probably damaging	Het
Ccdc159	T	A	9: 21,934,519		probably null	Het
Cct7	A	T	6: 85,466,708	I353F	possibly damaging	Het
Fat1	G	C	8: 45,023,035	R1706T	probably benign	Het
Fn1	C	T	1: 71,607,913	G1482R	probably damaging	Het
Gcat	T	C	15: 79,043,331	L324P	possibly damaging	Het
Hspa1a	C	T	17: 34,971,727	V67M	probably damaging	Het
Il22	C	T	10: 118,205,624	R81*	probably null	Het
Impa1	T	C	3: 10,316,034	T263A	probably benign	Het
Kif13a	T	C	13: 46,802,690	Y609C	probably damaging	Het
Kmt2e	A	G	5: 23,501,626	N1396D	probably benign	Het
Lrfn1	G	A	7: 28,466,869	G563R	possibly damaging	Het
Mark1	A	C	1: 184,908,435		probably null	Het
Mum1	T	C	10: 80,238,316	V401A	probably damaging	Het
Mxd1	G	T	6: 86,650,960	Q199K	probably benign	Het
Myo3a	T	A	2: 22,558,215	Y1N	probably damaging	Het
Nek3	T	C	8: 22,133,091	E309G	probably benign	Het
Olfr63	T	C	17: 33,268,775	F17S	probably damaging	Het
Otoa	A	T	7: 121,125,565	Q489L	probably damaging	Het
Oxsr1	T	C	9: 119,247,112	E376G	probably benign	Het
Piezo1	C	T	8: 122,482,143	E2494K	probably damaging	Het
Pkd1l3	A	G	8: 109,646,879	H1349R	probably benign	Het
Psmd2	A	G	16: 20,655,642	D316G	probably benign	Het
Robo4	T	A	9: 37,403,505	C218*	probably null	Het
Rxfp2	A	T	5: 150,055,985		probably null	Het
Slc10a1	A	G	12: 80,967,667	I93T	probably damaging	Het
Tarbp1	C	T	8: 126,428,152	R1411Q	probably damaging	Het
Tbl3	C	T	17: 24,702,032	D563N	probably damaging	Het
Tec	A	G	5: 72,760,362	S505P	probably damaging	Het
Toporsl	A	T	4: 52,611,750	R548*	probably null	Het
Vmn1r39	G	A	6: 66,804,495	Q243*	probably null	Het
Vmn2r9	C	A	5: 108,847,919	A288S	probably benign	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
R9442:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R9525:Cfap57	UTSW	4	118576581	missense	probably damaging	1.00
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCCATTCAGGGGCATCAAAGAG -3'
(R):5'- TGTATACTCTGCTCACCCAGG -3'

Sequencing Primer
(F):5'- TAGTGAGCTGGCATGACAC -3'
(R):5'- AGGTATGCCTGCACCCCTTG -3'

Posted On

2015-04-17