Incidental Mutation 'R3905:Vmn2r9'
ID309139
Institutional Source Beutler Lab
Gene Symbol Vmn2r9
Ensembl Gene ENSMUSG00000091624
Gene Namevomeronasal 2, receptor 9
SynonymsEG435864
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R3905 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108842947-108852510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108847919 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 288 (A288S)
Ref Sequence ENSEMBL: ENSMUSP00000129520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170419]
Predicted Effect probably benign
Transcript: ENSMUST00000170419
AA Change: A288S

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129520
Gene: ENSMUSG00000091624
AA Change: A288S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 77 412 8.1e-29 PFAM
Pfam:NCD3G 507 561 2.3e-16 PFAM
Pfam:7tm_3 592 829 3.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176157
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Other mutations in Vmn2r9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Vmn2r9 APN 5 108848024 missense possibly damaging 0.79
IGL00972:Vmn2r9 APN 5 108849037 missense probably benign 0.02
IGL01102:Vmn2r9 APN 5 108842945 unclassified probably null
IGL01892:Vmn2r9 APN 5 108847834 missense probably damaging 1.00
IGL02086:Vmn2r9 APN 5 108847567 missense probably damaging 1.00
IGL02118:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02119:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02120:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02121:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02123:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02131:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02132:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02171:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02185:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02186:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02346:Vmn2r9 APN 5 108842984 missense probably benign 0.07
IGL02508:Vmn2r9 APN 5 108848201 missense possibly damaging 0.70
IGL02815:Vmn2r9 APN 5 108842990 missense possibly damaging 0.69
IGL03077:Vmn2r9 APN 5 108848307 splice site probably benign
IGL03269:Vmn2r9 APN 5 108847954 missense probably damaging 1.00
IGL03293:Vmn2r9 APN 5 108848131 missense probably damaging 1.00
R0112:Vmn2r9 UTSW 5 108843125 missense probably damaging 1.00
R0328:Vmn2r9 UTSW 5 108847539 missense probably benign 0.11
R0382:Vmn2r9 UTSW 5 108847597 missense probably damaging 1.00
R0521:Vmn2r9 UTSW 5 108848288 nonsense probably null
R0975:Vmn2r9 UTSW 5 108843303 missense probably damaging 1.00
R1216:Vmn2r9 UTSW 5 108847574 missense probably damaging 1.00
R1458:Vmn2r9 UTSW 5 108848984 missense probably benign 0.44
R1469:Vmn2r9 UTSW 5 108843828 missense probably benign
R1469:Vmn2r9 UTSW 5 108843828 missense probably benign
R1704:Vmn2r9 UTSW 5 108846400 missense probably damaging 1.00
R1967:Vmn2r9 UTSW 5 108847522 missense probably benign 0.03
R1991:Vmn2r9 UTSW 5 108846439 missense probably damaging 0.99
R2410:Vmn2r9 UTSW 5 108848257 missense probably damaging 1.00
R3419:Vmn2r9 UTSW 5 108846433 missense probably damaging 0.96
R3852:Vmn2r9 UTSW 5 108848131 missense probably damaging 1.00
R3873:Vmn2r9 UTSW 5 108847835 missense probably benign 0.14
R3908:Vmn2r9 UTSW 5 108847919 missense probably benign 0.37
R3921:Vmn2r9 UTSW 5 108849055 missense probably benign
R4156:Vmn2r9 UTSW 5 108847877 missense possibly damaging 0.64
R4477:Vmn2r9 UTSW 5 108846277 missense probably benign
R4478:Vmn2r9 UTSW 5 108846277 missense probably benign
R4544:Vmn2r9 UTSW 5 108847685 missense probably benign 0.00
R4546:Vmn2r9 UTSW 5 108847685 missense probably benign 0.00
R4627:Vmn2r9 UTSW 5 108847597 missense probably damaging 1.00
R5215:Vmn2r9 UTSW 5 108846485 missense probably benign 0.03
R5361:Vmn2r9 UTSW 5 108848063 missense probably damaging 1.00
R5587:Vmn2r9 UTSW 5 108847561 missense probably damaging 1.00
R6054:Vmn2r9 UTSW 5 108848260 missense probably damaging 0.99
R6106:Vmn2r9 UTSW 5 108845036 missense probably benign
R6125:Vmn2r9 UTSW 5 108842970 missense probably benign 0.01
R6137:Vmn2r9 UTSW 5 108849016 missense probably benign 0.00
R6920:Vmn2r9 UTSW 5 108849046 missense possibly damaging 0.72
R7579:Vmn2r9 UTSW 5 108845082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATTGTGCAGTGCTGTCC -3'
(R):5'- GCAAAGACATGGAATCTGTTTAGC -3'

Sequencing Primer
(F):5'- AAAATTGTGCAGTGCTGTCCATTCC -3'
(R):5'- AGACATGGAATCTGTTTAGCTTTTG -3'
Posted On2015-04-17