Incidental Mutation 'R3905:Cct7'
ID309142
Institutional Source Beutler Lab
Gene Symbol Cct7
Ensembl Gene ENSMUSG00000030007
Gene Namechaperonin containing Tcp1, subunit 7 (eta)
SynonymsCctz, Ccth
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R3905 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location85451514-85468475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85466708 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 353 (I353F)
Ref Sequence ENSEMBL: ENSMUSP00000032078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032078] [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546] [ENSMUST00000204489] [ENSMUST00000204592]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032078
AA Change: I353F

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032078
Gene: ENSMUSG00000030007
AA Change: I353F

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 32 524 1.8e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159062
SMART Domains Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161078
SMART Domains Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161546
SMART Domains Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
Pfam:F-box-like 554 593 5.6e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204489
SMART Domains Protein: ENSMUSP00000144919
Gene: ENSMUSG00000030007

DomainStartEndE-ValueType
PDB:4B2T|H 1 53 2e-29 PDB
Blast:VWA 5 51 4e-7 BLAST
SCOP:d1a6da1 16 51 2e-8 SMART
low complexity region 68 80 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000204592
AA Change: I311F

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144893
Gene: ENSMUSG00000030007
AA Change: I311F

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 32 91 6e-21 PFAM
Pfam:Cpn60_TCP1 88 482 5e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205143
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 5 and 6. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Cct7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02223:Cct7 APN 6 85462041 missense probably benign 0.00
IGL02292:Cct7 APN 6 85461109 missense probably benign 0.03
IGL02724:Cct7 APN 6 85459149 missense probably damaging 1.00
IGL02740:Cct7 APN 6 85468270 missense probably benign
PIT4495001:Cct7 UTSW 6 85459961 missense probably damaging 1.00
R0184:Cct7 UTSW 6 85461554 missense probably null 0.55
R1363:Cct7 UTSW 6 85466035 missense probably damaging 1.00
R1378:Cct7 UTSW 6 85467563 intron probably null
R2076:Cct7 UTSW 6 85468140 missense probably damaging 0.98
R2210:Cct7 UTSW 6 85459230 missense probably damaging 1.00
R4298:Cct7 UTSW 6 85468173 missense probably damaging 1.00
R4422:Cct7 UTSW 6 85467145 missense probably damaging 0.98
R6519:Cct7 UTSW 6 85462150 missense probably benign 0.19
R6903:Cct7 UTSW 6 85466693 missense probably benign 0.27
R6925:Cct7 UTSW 6 85459182 missense probably damaging 1.00
R7133:Cct7 UTSW 6 85466645 missense probably benign 0.02
R7458:Cct7 UTSW 6 85459996 missense probably benign 0.14
R8133:Cct7 UTSW 6 85461063 missense probably damaging 1.00
Z1177:Cct7 UTSW 6 85466669 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGGTGGGCTATCCTATGCAG -3'
(R):5'- TGCTGTGGTATCACTGAAGCATC -3'

Sequencing Primer
(F):5'- TATCCTATGCAGAGGGCTCAG -3'
(R):5'- CTGTGGTATCACTGAAGCATCAAAGC -3'
Posted On2015-04-17