Incidental Mutation 'R3905:Mxd1'
ID309143
Institutional Source Beutler Lab
Gene Symbol Mxd1
Ensembl Gene ENSMUSG00000001156
Gene NameMAX dimerization protein 1
SynonymsMad1, Mad
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R3905 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86647042-86669161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86650960 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 199 (Q199K)
Ref Sequence ENSEMBL: ENSMUSP00000001184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001184] [ENSMUST00000203946] [ENSMUST00000204437]
Predicted Effect probably benign
Transcript: ENSMUST00000001184
AA Change: Q199K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000001184
Gene: ENSMUSG00000001156
AA Change: Q199K

DomainStartEndE-ValueType
PDB:1PD7|B 5 28 6e-7 PDB
HLH 61 113 1.14e-9 SMART
low complexity region 143 175 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203946
SMART Domains Protein: ENSMUSP00000145081
Gene: ENSMUSG00000001156

DomainStartEndE-ValueType
HLH 6 58 4.8e-12 SMART
low complexity region 88 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204437
SMART Domains Protein: ENSMUSP00000145396
Gene: ENSMUSG00000001156

DomainStartEndE-ValueType
PDB:1PD7|B 5 28 3e-8 PDB
Meta Mutation Damage Score 0.1005 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MYC/MAX/MAD network of basic helix-loop-helix leucine zipper transcription factors. The MYC/MAX/MAD transcription factors mediate cellular proliferation, differentiation and apoptosis. The encoded protein antagonizes MYC-mediated transcriptional activation of target genes by competing for the binding partner MAX and recruiting repressor complexes containing histone deacetylases. Mutations in this gene may play a role in acute leukemia, and the encoded protein is a potential tumor suppressor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered myelopoiesis, increased proliferative potential of bone marrow granulocytic precursors, increased sensitivity of myeloid cells to apoptosis-inducing stimuli, and inhibited cell cycle withdrawal during a late stage of granulocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Mxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
LCD18:Mxd1 UTSW 6 86667406 intron probably benign
R1385:Mxd1 UTSW 6 86651567 missense probably damaging 0.96
R1510:Mxd1 UTSW 6 86653155 missense possibly damaging 0.96
R1595:Mxd1 UTSW 6 86651471 missense possibly damaging 0.93
R2126:Mxd1 UTSW 6 86651440 critical splice donor site probably null
R3907:Mxd1 UTSW 6 86650960 missense probably benign 0.44
R3909:Mxd1 UTSW 6 86650960 missense probably benign 0.44
R6048:Mxd1 UTSW 6 86650984 missense probably damaging 1.00
R7060:Mxd1 UTSW 6 86653159 missense probably damaging 1.00
R7351:Mxd1 UTSW 6 86651466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGCTGCTATTGGTCAAGG -3'
(R):5'- TAGCCTCCCCTCTGTAAGAG -3'

Sequencing Primer
(F):5'- CTATTGGTCAAGGTGGTACATGAG -3'
(R):5'- CCCCTCTGTAAGAGTTAGGTAGC -3'
Posted On2015-04-17