Mutagenetix > Incidental Mutation

Incidental Mutation 'R3905:Tarbp1'

309151

Institutional Source

Beutler Lab

Gene Symbol

Tarbp1

Ensembl Gene

ENSMUSG00000090290

Gene Name

TAR RNA binding protein 1

Synonyms

Gm17296

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3905 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

126425329-126475065 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 126428152 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 1411 (R1411Q)

Ref Sequence

ENSEMBL: ENSMUSP00000129815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059093] [ENSMUST00000170518] [ENSMUST00000211868]

AlphaFold

E9Q368

Predicted Effect

probably benign
Transcript: ENSMUST00000059093

SMART Domains

Protein: ENSMUSP00000058279
Gene: ENSMUSG00000051671

Domain	Start	End	E-Value	Type
Pfam:COX6B	1	67	6e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170518
AA Change: R1411Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: R1411Q

Domain	Start	End	E-Value	Type
low complexity region	17	31	N/A	INTRINSIC
low complexity region	47	57	N/A	INTRINSIC
low complexity region	77	97	N/A	INTRINSIC
low complexity region	112	127	N/A	INTRINSIC
low complexity region	195	207	N/A	INTRINSIC
SCOP:d1gw5a_	1059	1260	3e-3	SMART
Pfam:SpoU_methylase	1421	1564	2.2e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211868

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	T	1: 71,268,230	I1964N	possibly damaging	Het
Abca12	A	G	1: 71,279,457	F1796L	probably benign	Het
Abca17	T	A	17: 24,296,283	M821L	probably benign	Het
Adamts3	C	A	5: 89,861,355	G150C	probably damaging	Het
Ap4b1	A	T	3: 103,818,893	I262F	possibly damaging	Het
Atp1a1	T	A	3: 101,590,612	E286D	probably benign	Het
Bard1	T	C	1: 71,067,180	I429M	possibly damaging	Het
Bcl7c	T	C	7: 127,666,983	R198G	possibly damaging	Het
Cacna1s	T	A	1: 136,084,269	M483K	probably damaging	Het
Ccdc159	T	A	9: 21,934,519		probably null	Het
Cct7	A	T	6: 85,466,708	I353F	possibly damaging	Het
Cfap57	A	G	4: 118,595,839	Y556H	probably damaging	Het
Fat1	G	C	8: 45,023,035	R1706T	probably benign	Het
Fn1	C	T	1: 71,607,913	G1482R	probably damaging	Het
Gcat	T	C	15: 79,043,331	L324P	possibly damaging	Het
Hspa1a	C	T	17: 34,971,727	V67M	probably damaging	Het
Il22	C	T	10: 118,205,624	R81*	probably null	Het
Impa1	T	C	3: 10,316,034	T263A	probably benign	Het
Kif13a	T	C	13: 46,802,690	Y609C	probably damaging	Het
Kmt2e	A	G	5: 23,501,626	N1396D	probably benign	Het
Lrfn1	G	A	7: 28,466,869	G563R	possibly damaging	Het
Mark1	A	C	1: 184,908,435		probably null	Het
Mum1	T	C	10: 80,238,316	V401A	probably damaging	Het
Mxd1	G	T	6: 86,650,960	Q199K	probably benign	Het
Myo3a	T	A	2: 22,558,215	Y1N	probably damaging	Het
Nek3	T	C	8: 22,133,091	E309G	probably benign	Het
Olfr63	T	C	17: 33,268,775	F17S	probably damaging	Het
Otoa	A	T	7: 121,125,565	Q489L	probably damaging	Het
Oxsr1	T	C	9: 119,247,112	E376G	probably benign	Het
Piezo1	C	T	8: 122,482,143	E2494K	probably damaging	Het
Pkd1l3	A	G	8: 109,646,879	H1349R	probably benign	Het
Psmd2	A	G	16: 20,655,642	D316G	probably benign	Het
Robo4	T	A	9: 37,403,505	C218*	probably null	Het
Rxfp2	A	T	5: 150,055,985		probably null	Het
Slc10a1	A	G	12: 80,967,667	I93T	probably damaging	Het
Tbl3	C	T	17: 24,702,032	D563N	probably damaging	Het
Tec	A	G	5: 72,760,362	S505P	probably damaging	Het
Toporsl	A	T	4: 52,611,750	R548*	probably null	Het
Vmn1r39	G	A	6: 66,804,495	Q243*	probably null	Het
Vmn2r9	C	A	5: 108,847,919	A288S	probably benign	Het

Other mutations in Tarbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Tarbp1	APN	8	126459161	missense	probably damaging	1.00
IGL01419:Tarbp1	APN	8	126428155	missense	probably benign	0.03
IGL01475:Tarbp1	APN	8	126433962	missense	probably benign	0.03
IGL01688:Tarbp1	APN	8	126447551	missense	probably damaging	1.00
IGL01772:Tarbp1	APN	8	126447231	splice site	probably benign
IGL02402:Tarbp1	APN	8	126450828	splice site	probably benign
IGL02899:Tarbp1	APN	8	126453844	missense	probably damaging	0.96
IGL03006:Tarbp1	APN	8	126444142	missense	probably damaging	1.00
IGL03273:Tarbp1	APN	8	126453835	missense	probably damaging	1.00
PIT4280001:Tarbp1	UTSW	8	126430847	missense	probably damaging	0.96
R0048:Tarbp1	UTSW	8	126447530	missense	probably damaging	1.00
R0309:Tarbp1	UTSW	8	126438928	splice site	probably benign
R0383:Tarbp1	UTSW	8	126447484	missense	probably benign	0.00
R0455:Tarbp1	UTSW	8	126440873	missense	probably benign	0.00
R0738:Tarbp1	UTSW	8	126438801	critical splice donor site	probably null
R1345:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1370:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1617:Tarbp1	UTSW	8	126444268	missense	possibly damaging	0.47
R1628:Tarbp1	UTSW	8	126430860	missense	possibly damaging	0.78
R1702:Tarbp1	UTSW	8	126428218	missense	probably damaging	1.00
R1873:Tarbp1	UTSW	8	126447047	missense	probably damaging	1.00
R2018:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2019:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2060:Tarbp1	UTSW	8	126447594	splice site	probably null
R2877:Tarbp1	UTSW	8	126427832	missense	probably damaging	1.00
R3008:Tarbp1	UTSW	8	126447421	missense	possibly damaging	0.46
R3875:Tarbp1	UTSW	8	126438799	splice site	probably benign
R3923:Tarbp1	UTSW	8	126440771	missense	probably benign	0.00
R4420:Tarbp1	UTSW	8	126447080	missense	possibly damaging	0.59
R4570:Tarbp1	UTSW	8	126452233	missense	probably benign	0.00
R4610:Tarbp1	UTSW	8	126474330	missense	probably damaging	1.00
R4649:Tarbp1	UTSW	8	126447195	missense	probably damaging	0.96
R4802:Tarbp1	UTSW	8	126474889	missense	possibly damaging	0.75
R4951:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R4953:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R5254:Tarbp1	UTSW	8	126467156	missense	probably damaging	0.96
R5255:Tarbp1	UTSW	8	126428970	missense	probably benign	0.16
R5638:Tarbp1	UTSW	8	126450686	missense	probably damaging	1.00
R5696:Tarbp1	UTSW	8	126447340	missense	probably damaging	0.98
R5707:Tarbp1	UTSW	8	126467144	missense	probably damaging	1.00
R5896:Tarbp1	UTSW	8	126452928	missense	probably benign	0.05
R6087:Tarbp1	UTSW	8	126428970	missense	probably benign	0.00
R6117:Tarbp1	UTSW	8	126427541	missense	probably benign	0.00
R6132:Tarbp1	UTSW	8	126434809	missense	probably benign	0.17
R6168:Tarbp1	UTSW	8	126448405	missense	possibly damaging	0.89
R6419:Tarbp1	UTSW	8	126459044	missense	possibly damaging	0.95
R6482:Tarbp1	UTSW	8	126450695	missense	probably benign	0.01
R6766:Tarbp1	UTSW	8	126447400	missense	probably benign	0.41
R6775:Tarbp1	UTSW	8	126436829	missense	probably benign	0.16
R6960:Tarbp1	UTSW	8	126429039	missense	possibly damaging	0.88
R7054:Tarbp1	UTSW	8	126474495	missense	possibly damaging	0.85
R7068:Tarbp1	UTSW	8	126427034	missense	probably damaging	1.00
R7454:Tarbp1	UTSW	8	126457677	missense	probably benign	0.19
R7519:Tarbp1	UTSW	8	126433900	missense	possibly damaging	0.87
R7760:Tarbp1	UTSW	8	126452807	missense	not run
R7837:Tarbp1	UTSW	8	126474561	missense	probably benign	0.00
R7882:Tarbp1	UTSW	8	126456493	missense	probably damaging	1.00
R7982:Tarbp1	UTSW	8	126444301	missense	probably damaging	1.00
R8166:Tarbp1	UTSW	8	126427128	missense	possibly damaging	0.79
R8517:Tarbp1	UTSW	8	126444195	missense	probably benign	0.29
R8838:Tarbp1	UTSW	8	126450830	splice site	probably benign
R8880:Tarbp1	UTSW	8	126471305	missense	probably damaging	1.00
R9061:Tarbp1	UTSW	8	126447141	missense	probably damaging	1.00
R9123:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9125:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9364:Tarbp1	UTSW	8	126450723	missense	probably benign	0.01
R9474:Tarbp1	UTSW	8	126429040	missense	probably benign	0.44
R9670:Tarbp1	UTSW	8	126456523	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GCATGTCACAAGGTTCACACC -3'
(R):5'- TGGGCTGTATACAAGTGTTAACAAG -3'

Sequencing Primer
(F):5'- GGTTCACACCACCCCGG -3'
(R):5'- ACTTTGGGTGAAGCAGAC -3'

Posted On

2015-04-17