Incidental Mutation 'R3905:Ccdc159'
ID309152
Institutional Source Beutler Lab
Gene Symbol Ccdc159
Ensembl Gene ENSMUSG00000006241
Gene Namecoiled-coil domain containing 159
Synonyms2510048L02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3905 (G1)
Quality Score208
Status Not validated
Chromosome9
Chromosomal Location21927471-21935872 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 21934519 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006403] [ENSMUST00000046371] [ENSMUST00000170304] [ENSMUST00000188468] [ENSMUST00000190387] [ENSMUST00000214734] [ENSMUST00000216710]
Predicted Effect probably null
Transcript: ENSMUST00000006403
SMART Domains Protein: ENSMUSP00000006403
Gene: ENSMUSG00000006241

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
coiled coil region 152 172 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
coiled coil region 261 288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046371
SMART Domains Protein: ENSMUSP00000038616
Gene: ENSMUSG00000040563

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
acidPPc 130 281 2.31e-9 SMART
low complexity region 363 422 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170304
SMART Domains Protein: ENSMUSP00000126474
Gene: ENSMUSG00000006241

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 160 180 N/A INTRINSIC
low complexity region 225 235 N/A INTRINSIC
coiled coil region 269 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188468
SMART Domains Protein: ENSMUSP00000140166
Gene: ENSMUSG00000040563

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
transmembrane domain 46 63 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
acidPPc 105 256 1.1e-11 SMART
low complexity region 338 397 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190387
SMART Domains Protein: ENSMUSP00000139727
Gene: ENSMUSG00000040563

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
acidPPc 130 281 2.31e-9 SMART
low complexity region 322 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214734
Predicted Effect probably null
Transcript: ENSMUST00000216710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217589
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Ccdc159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Ccdc159 APN 9 21929469 missense possibly damaging 0.83
IGL02322:Ccdc159 APN 9 21929373 missense possibly damaging 0.46
IGL03156:Ccdc159 APN 9 21929475 missense probably benign
IGL03382:Ccdc159 APN 9 21931696 splice site probably null
R1622:Ccdc159 UTSW 9 21929370 missense possibly damaging 0.66
R2076:Ccdc159 UTSW 9 21929506 unclassified probably null
R4083:Ccdc159 UTSW 9 21929403 missense possibly damaging 0.83
R4625:Ccdc159 UTSW 9 21929466 missense probably benign
R4700:Ccdc159 UTSW 9 21927731 splice site probably null
R5004:Ccdc159 UTSW 9 21932945 missense probably damaging 1.00
R5743:Ccdc159 UTSW 9 21929390 missense probably benign 0.19
R6245:Ccdc159 UTSW 9 21935568 missense probably damaging 0.99
R7263:Ccdc159 UTSW 9 21931711 missense probably benign 0.04
R8171:Ccdc159 UTSW 9 21933711 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTGGAACCCAGTTGATTCCTAC -3'
(R):5'- GACTCGCCTTGGGTTTGAAG -3'

Sequencing Primer
(F):5'- AGTTGATTCCTACTTCTTCTGGG -3'
(R):5'- GGGTTTGAAGTTCTCTTTCACC -3'
Posted On2015-04-17