Incidental Mutation 'R3905:Oxsr1'
ID309154
Institutional Source Beutler Lab
Gene Symbol Oxsr1
Ensembl Gene ENSMUSG00000036737
Gene Nameoxidative-stress responsive 1
Synonyms2210022N24Rik, Osr1, 2810422B09Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3905 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119238432-119322427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119247112 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 376 (E376G)
Ref Sequence ENSEMBL: ENSMUSP00000042155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040853] [ENSMUST00000128880] [ENSMUST00000143728] [ENSMUST00000170400]
Predicted Effect probably benign
Transcript: ENSMUST00000040853
AA Change: E376G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042155
Gene: ENSMUSG00000036737
AA Change: E376G

DomainStartEndE-ValueType
S_TKc 17 291 1.45e-84 SMART
low complexity region 332 350 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
Pfam:OSR1_C 434 465 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128880
SMART Domains Protein: ENSMUSP00000122692
Gene: ENSMUSG00000036737

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 100 6.3e-13 PFAM
Pfam:Pkinase 17 111 1.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136902
Predicted Effect probably benign
Transcript: ENSMUST00000143728
SMART Domains Protein: ENSMUSP00000117327
Gene: ENSMUSG00000036737

DomainStartEndE-ValueType
PDB:2VWI|D 1 32 2e-14 PDB
SCOP:d1f3mc_ 1 33 1e-7 SMART
low complexity region 61 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Oxsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Oxsr1 APN 9 119259211 missense probably damaging 1.00
IGL01380:Oxsr1 APN 9 119260101 intron probably benign
IGL02542:Oxsr1 APN 9 119242735 missense possibly damaging 0.67
IGL02806:Oxsr1 APN 9 119241194 missense possibly damaging 0.55
R0629:Oxsr1 UTSW 9 119241784 intron probably benign
R2048:Oxsr1 UTSW 9 119247074 missense probably benign
R2094:Oxsr1 UTSW 9 119294494 missense probably benign 0.22
R2159:Oxsr1 UTSW 9 119304814 missense possibly damaging 0.52
R2165:Oxsr1 UTSW 9 119294432 missense probably damaging 1.00
R6017:Oxsr1 UTSW 9 119264777 missense probably benign 0.00
R6286:Oxsr1 UTSW 9 119264882 missense probably damaging 0.99
R6899:Oxsr1 UTSW 9 119247122 missense probably benign 0.00
R7091:Oxsr1 UTSW 9 119284661 missense probably benign 0.03
R7683:Oxsr1 UTSW 9 119241755 missense probably benign 0.30
R7715:Oxsr1 UTSW 9 119242756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTATCATCTGCCCACAGG -3'
(R):5'- GTCTCGACTACCTAGCAAGTTGC -3'

Sequencing Primer
(F):5'- GCGTCGGGCCAGGAAAAC -3'
(R):5'- GCAAGTTGCAGACCAGCCTC -3'
Posted On2015-04-17