Incidental Mutation 'R3905:Mum1'
ID309157
Institutional Source Beutler Lab
Gene Symbol Mum1
Ensembl Gene ENSMUSG00000020156
Gene Namemelanoma associated antigen (mutated) 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3905 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80226434-80243903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80238316 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 401 (V401A)
Ref Sequence ENSEMBL: ENSMUSP00000020365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020365]
Predicted Effect probably damaging
Transcript: ENSMUST00000020365
AA Change: V401A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020365
Gene: ENSMUSG00000020156
AA Change: V401A

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
Pfam:PWWP 381 458 2.9e-8 PFAM
low complexity region 671 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146538
Meta Mutation Damage Score 0.6670 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Mum1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Mum1 APN 10 80234329 critical splice donor site probably null
IGL02152:Mum1 APN 10 80239978 missense probably damaging 1.00
IGL02541:Mum1 APN 10 80228439 critical splice donor site probably null
IGL02562:Mum1 APN 10 80238895 missense probably damaging 1.00
IGL02609:Mum1 APN 10 80230083 missense probably damaging 0.99
R0242:Mum1 UTSW 10 80234258 missense probably benign 0.02
R0242:Mum1 UTSW 10 80234258 missense probably benign 0.02
R0378:Mum1 UTSW 10 80238879 synonymous probably null
R0441:Mum1 UTSW 10 80229025 missense probably damaging 1.00
R0675:Mum1 UTSW 10 80230080 missense probably damaging 0.99
R1558:Mum1 UTSW 10 80232944 missense probably benign 0.05
R1612:Mum1 UTSW 10 80233055 unclassified probably benign
R1873:Mum1 UTSW 10 80232608 missense possibly damaging 0.93
R2247:Mum1 UTSW 10 80240425 missense probably damaging 1.00
R3907:Mum1 UTSW 10 80238316 missense probably damaging 1.00
R3908:Mum1 UTSW 10 80238316 missense probably damaging 1.00
R4468:Mum1 UTSW 10 80240736 intron probably benign
R4657:Mum1 UTSW 10 80233014 missense probably benign 0.00
R4989:Mum1 UTSW 10 80232868 missense probably benign 0.01
R5030:Mum1 UTSW 10 80240375 intron probably benign
R5133:Mum1 UTSW 10 80232868 missense probably benign 0.01
R5134:Mum1 UTSW 10 80232868 missense probably benign 0.01
R5239:Mum1 UTSW 10 80228421 nonsense probably null
R6119:Mum1 UTSW 10 80229031 missense probably benign 0.25
R6253:Mum1 UTSW 10 80233014 missense probably benign 0.00
R6526:Mum1 UTSW 10 80232279 missense probably benign 0.18
R7421:Mum1 UTSW 10 80232753 missense probably benign 0.38
R8116:Mum1 UTSW 10 80240397 missense probably damaging 1.00
R8252:Mum1 UTSW 10 80241860 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCCAAATGGAGACTTGTGGATTC -3'
(R):5'- CTGAAACTCTGCTCTGGTGC -3'

Sequencing Primer
(F):5'- GATTCTACCTTGTAATACCACAGAGC -3'
(R):5'- TCTGGCTGAAACACCAAGTG -3'
Posted On2015-04-17