Incidental Mutation 'R3905:Slc10a1'
ID309160
Institutional Source Beutler Lab
Gene Symbol Slc10a1
Ensembl Gene ENSMUSG00000021135
Gene Namesolute carrier family 10 (sodium/bile acid cotransporter family), member 1
SynonymsNtcp, sodium bile acid cotransporting polypeptide
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3905 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location80953183-80968705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80967667 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 93 (I93T)
Ref Sequence ENSEMBL: ENSMUSP00000151555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095572] [ENSMUST00000218162] [ENSMUST00000218342] [ENSMUST00000220266]
Predicted Effect probably damaging
Transcript: ENSMUST00000095572
AA Change: I93T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093229
Gene: ENSMUSG00000021135
AA Change: I93T

DomainStartEndE-ValueType
Pfam:SBF 32 217 3.3e-47 PFAM
transmembrane domain 222 244 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218162
AA Change: I93T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218342
AA Change: I93T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000220266
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sodium/bile acid cotransporter family, which are integral membrane glycoproteins that participate in the enterohepatic circulation of bile acids. Two homologous transporters are involved in the reabsorption of bile acids; the ileal sodium/bile acid cotransporter with an apical cell localization that absorbs bile acids from the intestinal lumen, bile duct and kidney, and the liver-specific sodium/bile acid cotransporter, represented by this protein, that is found in the basolateral membranes of hepatocytes. Bile acids are the catabolic product of cholesterol metabolism, hence this protein is important for cholesterol homeostasis. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Slc10a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Slc10a1 APN 12 80960528 missense probably benign 0.00
IGL02065:Slc10a1 APN 12 80960474 missense possibly damaging 0.94
R0212:Slc10a1 UTSW 12 80967712 missense possibly damaging 0.62
R1170:Slc10a1 UTSW 12 80956028 missense probably damaging 1.00
R1261:Slc10a1 UTSW 12 80967830 missense probably damaging 1.00
R1832:Slc10a1 UTSW 12 80953672 missense probably benign 0.23
R2010:Slc10a1 UTSW 12 80960447 missense probably benign 0.00
R2094:Slc10a1 UTSW 12 80956048 missense possibly damaging 0.88
R2206:Slc10a1 UTSW 12 80967628 missense probably damaging 0.99
R4392:Slc10a1 UTSW 12 80967804 missense probably damaging 1.00
R4413:Slc10a1 UTSW 12 80958132 missense probably benign 0.01
R5173:Slc10a1 UTSW 12 80956028 missense probably damaging 1.00
R5344:Slc10a1 UTSW 12 80953766 missense possibly damaging 0.56
R7173:Slc10a1 UTSW 12 80955976 missense probably damaging 1.00
R7253:Slc10a1 UTSW 12 80958184 missense probably benign 0.16
R7413:Slc10a1 UTSW 12 80960622 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCCAATTTAGCATAAACCTTTG -3'
(R):5'- ATCATGCTCTCGCTTGGCTG -3'

Sequencing Primer
(F):5'- GCATAAACCTTTGACAATCAATGC -3'
(R):5'- CTGCACCATGGAGTTCAGCAAG -3'
Posted On2015-04-17