Incidental Mutation 'R3905:Psmd2'
ID309162
Institutional Source Beutler Lab
Gene Symbol Psmd2
Ensembl Gene ENSMUSG00000006998
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 2
SynonymsTEG-190, Tex190, 9430095H01Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R3905 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20651652-20663414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20655642 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 316 (D316G)
Ref Sequence ENSEMBL: ENSMUSP00000007212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007212] [ENSMUST00000172207] [ENSMUST00000232629]
Predicted Effect probably benign
Transcript: ENSMUST00000007212
AA Change: D316G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000007212
Gene: ENSMUSG00000006998
AA Change: D316G

DomainStartEndE-ValueType
Pfam:PC_rep 443 479 3.7e-9 PFAM
Pfam:PC_rep 480 514 1.3e-8 PFAM
low complexity region 571 581 N/A INTRINSIC
SCOP:d1gw5b_ 617 773 1e-8 SMART
PDB:4CR4|Z 653 906 3e-57 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169195
Predicted Effect probably benign
Transcript: ENSMUST00000172207
Predicted Effect probably benign
Transcript: ENSMUST00000231897
Predicted Effect probably benign
Transcript: ENSMUST00000232513
Predicted Effect probably benign
Transcript: ENSMUST00000232629
Meta Mutation Damage Score 0.1376 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. In addition to participation in proteasome function, this subunit may also participate in the TNF signalling pathway since it interacts with the tumor necrosis factor type 1 receptor. A pseudogene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Psmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Psmd2 APN 16 20659405 utr 5 prime probably null
IGL02348:Psmd2 APN 16 20654647 missense probably benign 0.07
IGL02352:Psmd2 APN 16 20656941 missense probably benign 0.13
IGL02359:Psmd2 APN 16 20656941 missense probably benign 0.13
R0012:Psmd2 UTSW 16 20661684 missense probably damaging 0.99
R0144:Psmd2 UTSW 16 20662225 splice site probably null
R0565:Psmd2 UTSW 16 20660426 missense probably null 0.63
R0739:Psmd2 UTSW 16 20655329 missense probably benign 0.01
R1075:Psmd2 UTSW 16 20659959 missense probably damaging 0.98
R1189:Psmd2 UTSW 16 20661894 missense probably benign 0.17
R1231:Psmd2 UTSW 16 20655585 missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20652284 missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20652284 missense possibly damaging 0.83
R1466:Psmd2 UTSW 16 20657965 unclassified probably benign
R1556:Psmd2 UTSW 16 20655585 missense possibly damaging 0.83
R1843:Psmd2 UTSW 16 20656582 missense probably benign 0.02
R2398:Psmd2 UTSW 16 20659472 missense possibly damaging 0.86
R2421:Psmd2 UTSW 16 20660106 intron probably null
R2520:Psmd2 UTSW 16 20663076 missense probably damaging 1.00
R3040:Psmd2 UTSW 16 20657567 missense probably benign 0.08
R3906:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R3909:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R4027:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4029:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4031:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4357:Psmd2 UTSW 16 20656652 missense probably benign
R4410:Psmd2 UTSW 16 20655026 missense probably damaging 0.96
R4678:Psmd2 UTSW 16 20659969 missense probably damaging 1.00
R4737:Psmd2 UTSW 16 20659815 unclassified probably benign
R4771:Psmd2 UTSW 16 20662679 missense probably damaging 0.99
R5081:Psmd2 UTSW 16 20661655 missense probably benign 0.14
R5124:Psmd2 UTSW 16 20652698 missense possibly damaging 0.93
R5801:Psmd2 UTSW 16 20654922 missense probably damaging 0.96
R6381:Psmd2 UTSW 16 20655273 missense probably benign 0.03
R6732:Psmd2 UTSW 16 20662636 missense probably benign 0.02
R6870:Psmd2 UTSW 16 20661843 missense probably benign 0.33
R7030:Psmd2 UTSW 16 20662133 missense probably damaging 1.00
R7137:Psmd2 UTSW 16 20652627 missense probably benign 0.12
R7432:Psmd2 UTSW 16 20654925 missense probably damaging 0.99
Z1176:Psmd2 UTSW 16 20662660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGACGTAGCAGTTTCTGATG -3'
(R):5'- AAGCCAGAGGGTCACAACTG -3'

Sequencing Primer
(F):5'- AGCAGTTTCTGATGCGACAC -3'
(R):5'- AGAGGGTCACAACTGCTTCC -3'
Posted On2015-04-17