Incidental Mutation 'R3905:Tbl3'
ID309164
Institutional Source Beutler Lab
Gene Symbol Tbl3
Ensembl Gene ENSMUSG00000040688
Gene Nametransducin (beta)-like 3
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R3905 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24697949-24707660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24702032 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 563 (D563N)
Ref Sequence ENSEMBL: ENSMUSP00000120911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019464] [ENSMUST00000126319]
Predicted Effect probably benign
Transcript: ENSMUST00000019464
SMART Domains Protein: ENSMUSP00000019464
Gene: ENSMUSG00000019320

DomainStartEndE-ValueType
PX 6 122 1.36e-2 SMART
SH3 160 218 1.55e0 SMART
SH3 234 289 1.8e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124864
Predicted Effect probably damaging
Transcript: ENSMUST00000126319
AA Change: D563N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120911
Gene: ENSMUSG00000040688
AA Change: D563N

DomainStartEndE-ValueType
WD40 54 94 3.08e0 SMART
WD40 97 137 2.38e-6 SMART
WD40 140 181 3.85e-1 SMART
WD40 184 223 6.94e-8 SMART
WD40 237 275 7.36e1 SMART
WD40 278 320 3.07e1 SMART
WD40 323 363 1.78e0 SMART
WD40 365 404 1.17e-5 SMART
WD40 410 450 8.16e-5 SMART
WD40 468 507 5.18e-7 SMART
WD40 510 549 8.1e-9 SMART
WD40 552 591 8.55e-8 SMART
WD40 594 633 2.93e-6 SMART
low complexity region 637 650 N/A INTRINSIC
Pfam:Utp13 654 788 3.7e-43 PFAM
low complexity region 792 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126342
Predicted Effect unknown
Transcript: ENSMUST00000130633
AA Change: D100N
SMART Domains Protein: ENSMUSP00000117818
Gene: ENSMUSG00000040688
AA Change: D100N

DomainStartEndE-ValueType
WD40 2 38 8.75e-5 SMART
WD40 41 80 8.1e-9 SMART
WD40 90 129 9.52e-6 SMART
WD40 132 171 2.93e-6 SMART
low complexity region 175 188 N/A INTRINSIC
Pfam:Utp13 192 299 1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152527
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This gene has multiple polyadenylation sites. It might have multiple alternatively spliced transcript variants but the variants have not been fully described yet. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Tbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Tbl3 APN 17 24701905 splice site probably benign
IGL01092:Tbl3 APN 17 24705252 missense probably damaging 1.00
IGL01601:Tbl3 APN 17 24702317 missense probably damaging 1.00
IGL01610:Tbl3 APN 17 24704044 missense probably damaging 1.00
IGL02214:Tbl3 APN 17 24704132 unclassified probably benign
IGL03027:Tbl3 APN 17 24701193 critical splice acceptor site probably null
FR4449:Tbl3 UTSW 17 24702544 unclassified probably benign
R0230:Tbl3 UTSW 17 24701333 missense probably damaging 1.00
R0288:Tbl3 UTSW 17 24701807 missense probably damaging 1.00
R0305:Tbl3 UTSW 17 24705461 missense probably damaging 1.00
R1104:Tbl3 UTSW 17 24701606 missense probably benign 0.02
R1920:Tbl3 UTSW 17 24704503 missense probably benign 0.04
R2513:Tbl3 UTSW 17 24704550 critical splice acceptor site probably null
R2570:Tbl3 UTSW 17 24703316 missense possibly damaging 0.47
R2851:Tbl3 UTSW 17 24702583 missense probably damaging 1.00
R3944:Tbl3 UTSW 17 24700708 missense possibly damaging 0.94
R4019:Tbl3 UTSW 17 24704721 missense probably damaging 0.98
R4745:Tbl3 UTSW 17 24705330 unclassified probably benign
R5288:Tbl3 UTSW 17 24705970 missense possibly damaging 0.88
R5605:Tbl3 UTSW 17 24700759 missense probably benign 0.06
R5791:Tbl3 UTSW 17 24704434 missense probably damaging 0.99
R6236:Tbl3 UTSW 17 24700743 missense probably benign 0.12
R6302:Tbl3 UTSW 17 24704671 missense probably benign 0.05
R6938:Tbl3 UTSW 17 24705213 missense possibly damaging 0.61
R7173:Tbl3 UTSW 17 24705259 missense probably benign
R7176:Tbl3 UTSW 17 24700758 missense probably benign 0.01
R7382:Tbl3 UTSW 17 24705291 missense probably benign 0.21
R7555:Tbl3 UTSW 17 24701976 critical splice donor site probably null
R7732:Tbl3 UTSW 17 24704162 missense probably benign 0.00
R7780:Tbl3 UTSW 17 24702231 missense probably damaging 1.00
R7899:Tbl3 UTSW 17 24702484 missense probably damaging 1.00
R7982:Tbl3 UTSW 17 24702484 missense probably damaging 1.00
R8108:Tbl3 UTSW 17 24700916 missense probably benign
RF005:Tbl3 UTSW 17 24702541 unclassified probably benign
X0022:Tbl3 UTSW 17 24705573 nonsense probably null
X0028:Tbl3 UTSW 17 24702321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTAATGGTCCACAGCTTCAGG -3'
(R):5'- TTTTACAGGCCACCGACGTG -3'

Sequencing Primer
(F):5'- TTCAGGAGCCCATCAGAGC -3'
(R):5'- GGAATGTCCAGTTCTCACCTACGG -3'
Posted On2015-04-17