Incidental Mutation 'R3905:Olfr63'
ID309165
Institutional Source Beutler Lab
Gene Symbol Olfr63
Ensembl Gene ENSMUSG00000054666
Gene Nameolfactory receptor 63
SynonymsGA_x6K02T2NTC5-9778-8828, M4, MOR267-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R3905 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33264676-33275644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33268775 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 17 (F17S)
Ref Sequence ENSEMBL: ENSMUSP00000150323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067840] [ENSMUST00000217023]
Predicted Effect probably damaging
Transcript: ENSMUST00000067840
AA Change: F17S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067207
Gene: ENSMUSG00000054666
AA Change: F17S

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1e-51 PFAM
Pfam:7tm_1 42 288 5.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215466
Predicted Effect probably damaging
Transcript: ENSMUST00000217023
AA Change: F17S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Olfr63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Olfr63 APN 17 33269655 missense probably benign 0.00
IGL02313:Olfr63 APN 17 33269665 missense probably benign
IGL02639:Olfr63 APN 17 33269395 missense possibly damaging 0.96
IGL02851:Olfr63 APN 17 33269354 missense probably benign 0.01
IGL03007:Olfr63 APN 17 33268883 missense probably damaging 0.98
IGL03206:Olfr63 APN 17 33268751 missense possibly damaging 0.46
R0143:Olfr63 UTSW 17 33269497 missense probably damaging 1.00
R0355:Olfr63 UTSW 17 33269135 missense probably damaging 0.98
R1115:Olfr63 UTSW 17 33268966 nonsense probably null
R1117:Olfr63 UTSW 17 33268966 nonsense probably null
R1567:Olfr63 UTSW 17 33269476 missense probably benign
R1986:Olfr63 UTSW 17 33269515 missense probably benign 0.00
R4612:Olfr63 UTSW 17 33269480 missense probably benign 0.20
R5650:Olfr63 UTSW 17 33268884 missense probably benign 0.05
R5855:Olfr63 UTSW 17 33269336 missense possibly damaging 0.81
R6712:Olfr63 UTSW 17 33269268 missense possibly damaging 0.76
R7873:Olfr63 UTSW 17 33269374 missense probably benign
R7956:Olfr63 UTSW 17 33269374 missense probably benign
X0026:Olfr63 UTSW 17 33269050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCTCACCAGGGTCACAG -3'
(R):5'- CATGTCAGACAGCATTCGGG -3'

Sequencing Primer
(F):5'- AGCTCACCAGGGTCACAGTTTTAG -3'
(R):5'- CATTCGGGGCGTGATGAC -3'
Posted On2015-04-17