Incidental Mutation 'R3905:Hspa1a'
ID309166
Institutional Source Beutler Lab
Gene Symbol Hspa1a
Ensembl Gene ENSMUSG00000091971
Gene Nameheat shock protein 1A
SynonymsHsp70.3, Hsp70-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3905 (G1)
Quality Score200
Status Not validated
Chromosome17
Chromosomal Location34969190-34972156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34971727 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 67 (V67M)
Ref Sequence ENSEMBL: ENSMUSP00000084586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007248] [ENSMUST00000087328] [ENSMUST00000173680]
Predicted Effect probably benign
Transcript: ENSMUST00000007248
SMART Domains Protein: ENSMUSP00000007248
Gene: ENSMUSG00000007033

DomainStartEndE-ValueType
Pfam:HSP70 8 614 6.5e-269 PFAM
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087328
AA Change: V67M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084586
Gene: ENSMUSG00000091971
AA Change: V67M

DomainStartEndE-ValueType
Pfam:HSP70 6 612 1.3e-268 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173680
SMART Domains Protein: ENSMUSP00000133726
Gene: ENSMUSG00000092609

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
internal_repeat_1 91 102 5.9e-5 PROSPERO
internal_repeat_1 113 124 5.9e-5 PROSPERO
low complexity region 134 146 N/A INTRINSIC
Meta Mutation Damage Score 0.6264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: At the cellular level, mice homozygous for a knock-out allele exhibit impaired thermotolerance and increased sensitivity to heat stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,268,230 I1964N possibly damaging Het
Abca12 A G 1: 71,279,457 F1796L probably benign Het
Abca17 T A 17: 24,296,283 M821L probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ap4b1 A T 3: 103,818,893 I262F possibly damaging Het
Atp1a1 T A 3: 101,590,612 E286D probably benign Het
Bard1 T C 1: 71,067,180 I429M possibly damaging Het
Bcl7c T C 7: 127,666,983 R198G possibly damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Ccdc159 T A 9: 21,934,519 probably null Het
Cct7 A T 6: 85,466,708 I353F possibly damaging Het
Cfap57 A G 4: 118,595,839 Y556H probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gcat T C 15: 79,043,331 L324P possibly damaging Het
Il22 C T 10: 118,205,624 R81* probably null Het
Impa1 T C 3: 10,316,034 T263A probably benign Het
Kif13a T C 13: 46,802,690 Y609C probably damaging Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrfn1 G A 7: 28,466,869 G563R possibly damaging Het
Mark1 A C 1: 184,908,435 probably null Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Myo3a T A 2: 22,558,215 Y1N probably damaging Het
Nek3 T C 8: 22,133,091 E309G probably benign Het
Olfr63 T C 17: 33,268,775 F17S probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Oxsr1 T C 9: 119,247,112 E376G probably benign Het
Piezo1 C T 8: 122,482,143 E2494K probably damaging Het
Pkd1l3 A G 8: 109,646,879 H1349R probably benign Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rxfp2 A T 5: 150,055,985 probably null Het
Slc10a1 A G 12: 80,967,667 I93T probably damaging Het
Tarbp1 C T 8: 126,428,152 R1411Q probably damaging Het
Tbl3 C T 17: 24,702,032 D563N probably damaging Het
Tec A G 5: 72,760,362 S505P probably damaging Het
Toporsl A T 4: 52,611,750 R548* probably null Het
Vmn1r39 G A 6: 66,804,495 Q243* probably null Het
Vmn2r9 C A 5: 108,847,919 A288S probably benign Het
Other mutations in Hspa1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Hspa1a APN 17 34970524 missense probably damaging 1.00
IGL03380:Hspa1a APN 17 34970277 missense probably benign 0.17
R1983:Hspa1a UTSW 17 34970962 missense probably benign 0.01
R2117:Hspa1a UTSW 17 34970479 missense probably damaging 1.00
R3825:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3906:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3908:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R3909:Hspa1a UTSW 17 34971727 missense probably damaging 1.00
R4301:Hspa1a UTSW 17 34970506 missense probably benign 0.11
R4453:Hspa1a UTSW 17 34970293 missense probably benign 0.32
R4610:Hspa1a UTSW 17 34971180 missense probably damaging 0.96
R4904:Hspa1a UTSW 17 34970451 missense probably damaging 1.00
R6253:Hspa1a UTSW 17 34970550 missense probably damaging 1.00
R6366:Hspa1a UTSW 17 34970524 missense probably damaging 1.00
R6478:Hspa1a UTSW 17 34970306 missense probably damaging 1.00
R6981:Hspa1a UTSW 17 34970291 splice site probably null
R8015:Hspa1a UTSW 17 34970649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCATGGACGAGATCTC -3'
(R):5'- TTCCATCCAGAGACAAGCG -3'

Sequencing Primer
(F):5'- GAGATCTCCTCCGGGAAGAAC -3'
(R):5'- TTCCAGAAGCAGAGCGC -3'
Posted On2015-04-17