Incidental Mutation 'R3906:Pla2g4f'
ID309169
Institutional Source Beutler Lab
Gene Symbol Pla2g4f
Ensembl Gene ENSMUSG00000046971
Gene Namephospholipase A2, group IVF
Synonyms4732472I07Rik, Pla2zeta
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120299957-120314165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120300499 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 825 (R825Q)
Ref Sequence ENSEMBL: ENSMUSP00000062607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054651]
Predicted Effect probably benign
Transcript: ENSMUST00000054651
AA Change: R825Q

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062607
Gene: ENSMUSG00000046971
AA Change: R825Q

DomainStartEndE-ValueType
C2 45 144 7.51e-11 SMART
PLAc 285 797 1.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142183
Meta Mutation Damage Score 0.1132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Pla2g4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Pla2g4f APN 2 120302738 missense possibly damaging 0.53
IGL01652:Pla2g4f APN 2 120302235 missense possibly damaging 0.86
IGL02792:Pla2g4f APN 2 120303369 missense probably damaging 1.00
R0625:Pla2g4f UTSW 2 120305041 missense probably damaging 1.00
R1760:Pla2g4f UTSW 2 120314066 unclassified probably benign
R1799:Pla2g4f UTSW 2 120311068 missense possibly damaging 0.49
R2212:Pla2g4f UTSW 2 120303106 missense probably benign
R2351:Pla2g4f UTSW 2 120300442 missense probably benign 0.01
R3412:Pla2g4f UTSW 2 120303106 missense probably benign
R3414:Pla2g4f UTSW 2 120303106 missense probably benign
R4084:Pla2g4f UTSW 2 120312325 missense probably benign 0.36
R4477:Pla2g4f UTSW 2 120303672 missense probably damaging 1.00
R4529:Pla2g4f UTSW 2 120300619 missense probably damaging 0.99
R4606:Pla2g4f UTSW 2 120313986 missense probably benign 0.00
R4685:Pla2g4f UTSW 2 120305015 missense probably damaging 1.00
R4728:Pla2g4f UTSW 2 120300921 missense probably benign 0.19
R4782:Pla2g4f UTSW 2 120303276 missense probably damaging 1.00
R4957:Pla2g4f UTSW 2 120300499 missense probably benign 0.28
R5781:Pla2g4f UTSW 2 120305023 missense probably damaging 0.97
R6158:Pla2g4f UTSW 2 120301071 missense probably benign 0.21
R6232:Pla2g4f UTSW 2 120302221 missense possibly damaging 0.63
R6629:Pla2g4f UTSW 2 120308242 missense probably damaging 1.00
R6894:Pla2g4f UTSW 2 120303596 missense probably benign 0.44
R6939:Pla2g4f UTSW 2 120307301 missense probably damaging 1.00
R7131:Pla2g4f UTSW 2 120304554 missense probably null 0.01
R7221:Pla2g4f UTSW 2 120300995 missense probably benign 0.06
R7421:Pla2g4f UTSW 2 120307256 missense probably benign 0.07
R7767:Pla2g4f UTSW 2 120305009 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AAAGTGTTTAAAGTCTTCCCTCTCC -3'
(R):5'- AAGCCAGATCACCTGTGCAG -3'

Sequencing Primer
(F):5'- CCTCAGCATACTCTGACTTAAGG -3'
(R):5'- AGTGTCCAGGGCTATCAGCTAG -3'
Posted On2015-04-17