Incidental Mutation 'R3906:Cd1d1'
ID309172
Institutional Source Beutler Lab
Gene Symbol Cd1d1
Ensembl Gene ENSMUSG00000028076
Gene NameCD1d1 antigen
SynonymsCD1.1, Cd1d, Cd1a, Ly-38
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location86995834-86999441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86998756 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 71 (W71R)
Ref Sequence ENSEMBL: ENSMUSP00000029717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029717] [ENSMUST00000063869]
Predicted Effect probably damaging
Transcript: ENSMUST00000029717
AA Change: W71R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029717
Gene: ENSMUSG00000028076
AA Change: W71R

DomainStartEndE-ValueType
Pfam:MHC_I_3 1 200 1.3e-95 PFAM
IGc1 221 291 5.35e-22 SMART
transmembrane domain 304 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063869
AA Change: W71R

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070616
Gene: ENSMUSG00000028076
AA Change: W71R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4MQ7|A 23 73 2e-15 PDB
IGc1 90 160 5.35e-22 SMART
low complexity region 173 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142793
Meta Mutation Damage Score 0.9385 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a divergent member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack natural killer T cells, and mutant splenocytes fail to produce interleukin 4 (IL4). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Cd1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Cd1d1 APN 3 86998173 missense probably damaging 0.99
IGL01811:Cd1d1 APN 3 86996588 missense possibly damaging 0.86
IGL02371:Cd1d1 APN 3 86998881 missense probably benign 0.40
IGL03001:Cd1d1 APN 3 86998161 missense probably benign
R0350:Cd1d1 UTSW 3 86997573 missense probably benign 0.11
R1771:Cd1d1 UTSW 3 86998665 missense possibly damaging 0.85
R2407:Cd1d1 UTSW 3 86998182 missense probably damaging 1.00
R4540:Cd1d1 UTSW 3 86996705 missense probably benign 0.21
R4976:Cd1d1 UTSW 3 86998651 missense probably benign 0.00
R5303:Cd1d1 UTSW 3 86998120 missense probably benign 0.22
R5786:Cd1d1 UTSW 3 86998788 missense probably benign 0.17
R6088:Cd1d1 UTSW 3 86998702 missense probably benign 0.07
R6273:Cd1d1 UTSW 3 86998257 missense probably benign 0.00
R7315:Cd1d1 UTSW 3 86998113 missense possibly damaging 0.80
R7787:Cd1d1 UTSW 3 86997596 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGTTATCCAGCTGGGGTC -3'
(R):5'- CTACTGCAGTCTGTCCTCAG -3'

Sequencing Primer
(F):5'- AGCTGGGGTCTGGATCACTC -3'
(R):5'- GAGCCCACTCGCTAAGTTC -3'
Posted On2015-04-17