Incidental Mutation 'R3906:Ugt8a'
ID309173
Institutional Source Beutler Lab
Gene Symbol Ugt8a
Ensembl Gene ENSMUSG00000032854
Gene NameUDP galactosyltransferase 8A
SynonymsmCerGT, Cgt, Ugt8
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location125865271-125938619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125914982 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 160 (T160A)
Ref Sequence ENSEMBL: ENSMUSP00000143605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057944] [ENSMUST00000198610]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057944
AA Change: T160A

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050852
Gene: ENSMUSG00000032854
AA Change: T160A

DomainStartEndE-ValueType
Pfam:UDPGT 21 510 4.2e-121 PFAM
Pfam:Glyco_tran_28_C 326 437 6.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196481
Predicted Effect possibly damaging
Transcript: ENSMUST00000198610
AA Change: T160A

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143605
Gene: ENSMUSG00000032854
AA Change: T160A

DomainStartEndE-ValueType
Pfam:UDPGT 21 510 4.2e-121 PFAM
Pfam:Glyco_tran_28_C 326 437 6.4e-9 PFAM
Meta Mutation Damage Score 0.3514 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UDP-glycosyltransferase family. It catalyzes the transfer of galactose to ceramide, a key enzymatic step in the biosynthesis of galactocerebrosides, which are abundant sphingolipids of the myelin membrane of the central and peripheral nervous systems. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutants fail to make galactolipid galactocerebroside and its sulfated derivative that are normal myelin constituents. Mutants have tremors, ataxia, progressive hindlimb paralysis and vacuole formation in ventral spinal cord due to abnormal myelin sheath. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Ugt8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ugt8a APN 3 125914636 critical splice donor site probably null
IGL01934:Ugt8a APN 3 125914775 missense probably benign 0.18
IGL02435:Ugt8a APN 3 125867320 missense probably benign 0.00
IGL03050:Ugt8a UTSW 3 125875490 missense possibly damaging 0.63
R0041:Ugt8a UTSW 3 125915090 missense probably benign 0.00
R0453:Ugt8a UTSW 3 125914957 missense probably benign 0.03
R1314:Ugt8a UTSW 3 125871748 missense probably benign 0.00
R1544:Ugt8a UTSW 3 125915449 missense probably benign 0.06
R1566:Ugt8a UTSW 3 125875558 missense probably damaging 0.96
R1770:Ugt8a UTSW 3 125874203 missense probably benign 0.11
R2126:Ugt8a UTSW 3 125875546 missense probably damaging 0.98
R2972:Ugt8a UTSW 3 125915308 missense probably benign
R2973:Ugt8a UTSW 3 125915308 missense probably benign
R3547:Ugt8a UTSW 3 125867382 nonsense probably null
R3907:Ugt8a UTSW 3 125914982 missense possibly damaging 0.95
R4032:Ugt8a UTSW 3 125874158 missense probably damaging 1.00
R5235:Ugt8a UTSW 3 125867480 missense probably damaging 1.00
R5890:Ugt8a UTSW 3 125875553 missense probably benign 0.01
R6790:Ugt8a UTSW 3 125871691 missense possibly damaging 0.93
R6937:Ugt8a UTSW 3 125915601 start gained probably benign
R7298:Ugt8a UTSW 3 125915416 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CAGGCAGCAGGTTGTACTTC -3'
(R):5'- TTTTCTGGGAGATTGACAGCAG -3'

Sequencing Primer
(F):5'- TGCATTATCCTCTCATATTTCGGGAG -3'
(R):5'- GCAGTTGAACTGGTTGACATAC -3'
Posted On2015-04-17