Mutagenetix > Incidental Mutations

Incidental Mutation 'R3906:Abca1'

309175

Institutional Source

Beutler Lab

Gene Symbol

Abca1

Ensembl Gene

ENSMUSG00000015243

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 1

Synonyms

ABC1

MMRRC Submission

040813-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3906 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53030787-53159895 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53067151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1352 (V1352A)

Ref Sequence

ENSEMBL: ENSMUSP00000030010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030010]

AlphaFold

P41233

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030010
AA Change: V1352A

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: V1352A

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
Pfam:ABC2_membrane_3	395	841	4.9e-14	PFAM
AAA	925	1122	4.2e-10	SMART
low complexity region	1137	1150	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1344	1869	1.7e-53	PFAM
low complexity region	1890	1899	N/A	INTRINSIC
AAA	1938	2123	3.04e-7	SMART
low complexity region	2176	2187	N/A	INTRINSIC
low complexity region	2222	2237	N/A	INTRINSIC

Meta Mutation Damage Score

0.3639

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb7	G	T	X: 104,284,159	Q715K	probably benign	Het
Adamts3	C	A	5: 89,861,355	G150C	probably damaging	Het
Ank2	A	G	3: 127,016,898	L513P	probably damaging	Het
Cacng1	C	A	11: 107,716,292	V34L	probably benign	Het
Cd1d1	A	G	3: 86,998,756	W71R	probably damaging	Het
Cdhr3	A	G	12: 33,053,428	F397L	probably damaging	Het
Ces2a	A	G	8: 104,739,308	I325V	probably benign	Het
Ctsq	C	T	13: 61,038,771	V140M	probably damaging	Het
Cyp4f18	A	G	8: 72,001,082		probably benign	Het
Ddi2	T	C	4: 141,684,281	D440G	probably benign	Het
Dsg3	G	A	18: 20,538,499	G754R	probably damaging	Het
Endod1	T	A	9: 14,380,855	Y39F	probably benign	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Fn1	C	T	1: 71,607,913	G1482R	probably damaging	Het
Fpr2	A	G	17: 17,893,549	K269R	probably benign	Het
Frk	T	G	10: 34,584,056	L216V	probably benign	Het
Gan	G	A	8: 117,194,134	V370M	probably damaging	Het
Grik1	A	G	16: 88,006,449	I285T	probably benign	Het
Hspa1a	C	T	17: 34,971,727	V67M	probably damaging	Het
Kbtbd8	T	A	6: 95,126,584	Y405N	probably damaging	Het
Kcnj4	G	T	15: 79,485,745	H11Q	probably benign	Het
Kif26a	T	A	12: 112,176,890	S1193T	probably benign	Het
Kmt2e	A	G	5: 23,501,626	N1396D	probably benign	Het
Lasp1	G	A	11: 97,799,827	V12M	probably damaging	Het
Lrrk1	G	T	7: 66,294,903	T653K	possibly damaging	Het
Meiob	A	G	17: 24,827,948	Y182C	probably benign	Het
Myh6	T	C	14: 54,956,955	D739G	probably benign	Het
Ninl	T	C	2: 150,980,119	D21G	probably damaging	Het
Olfr1504	C	T	19: 13,887,706	C168Y	probably damaging	Het
Olfr743	C	T	14: 50,533,754	T114I	probably benign	Het
Pacsin2	A	C	15: 83,379,055	V125G	probably damaging	Het
Pfas	G	A	11: 68,988,286		probably benign	Het
Pla2g4f	C	T	2: 120,300,499	R825Q	probably benign	Het
Prkd1	A	T	12: 50,388,426	V506E	possibly damaging	Het
Psmd2	A	G	16: 20,655,642	D316G	probably benign	Het
Ryr2	T	A	13: 11,738,209	D1742V	possibly damaging	Het
Szt2	G	A	4: 118,378,269		probably benign	Het
Ugt8a	T	C	3: 125,914,982	T160A	possibly damaging	Het
Xrcc6	A	G	15: 82,029,571	T378A	probably benign	Het

Other mutations in Abca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Abca1	APN	4	53059255	critical splice donor site	probably null
IGL00778:Abca1	APN	4	53086132	missense	probably benign
IGL01013:Abca1	APN	4	53038185	nonsense	probably null
IGL01510:Abca1	APN	4	53143979	missense	probably damaging	0.97
IGL01608:Abca1	APN	4	53038158	missense	probably damaging	1.00
IGL01845:Abca1	APN	4	53090297	missense	probably damaging	1.00
IGL02048:Abca1	APN	4	53069831	missense	probably damaging	1.00
IGL02249:Abca1	APN	4	53068739	nonsense	probably null
IGL02569:Abca1	APN	4	53034061	missense	probably damaging	1.00
IGL02622:Abca1	APN	4	53034046	missense	probably damaging	0.99
R6720_abca1_529	UTSW	4	53083733	missense	probably damaging	1.00
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0050:Abca1	UTSW	4	53069910	splice site	probably benign
R0107:Abca1	UTSW	4	53080834	missense	probably benign	0.00
R0127:Abca1	UTSW	4	53067155	missense	probably benign	0.00
R0178:Abca1	UTSW	4	53081953	missense	possibly damaging	0.89
R0207:Abca1	UTSW	4	53086039	missense	probably damaging	0.97
R0267:Abca1	UTSW	4	53046105	missense	probably damaging	1.00
R0269:Abca1	UTSW	4	53044228	missense	probably benign
R0586:Abca1	UTSW	4	53092860	missense	probably benign	0.00
R0587:Abca1	UTSW	4	53107035	missense	probably benign	0.00
R1403:Abca1	UTSW	4	53059253	splice site	probably benign
R1404:Abca1	UTSW	4	53059253	splice site	probably benign
R1405:Abca1	UTSW	4	53059253	splice site	probably benign
R1558:Abca1	UTSW	4	53092887	missense	probably null	0.00
R1655:Abca1	UTSW	4	53050964	missense	probably benign
R1662:Abca1	UTSW	4	53090251	splice site	probably null
R1769:Abca1	UTSW	4	53074325	missense	probably damaging	1.00
R1898:Abca1	UTSW	4	53071977	missense	probably benign	0.08
R1945:Abca1	UTSW	4	53061509	frame shift	probably null
R1966:Abca1	UTSW	4	53050409	missense	probably damaging	1.00
R2055:Abca1	UTSW	4	53069881	missense	probably benign
R2185:Abca1	UTSW	4	53089830	missense	probably benign	0.12
R2202:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2203:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2204:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R3056:Abca1	UTSW	4	53127626	missense	probably benign
R3849:Abca1	UTSW	4	53061481	splice site	probably benign
R3850:Abca1	UTSW	4	53061481	splice site	probably benign
R3908:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R4050:Abca1	UTSW	4	53044144	missense	probably damaging	1.00
R4204:Abca1	UTSW	4	53090369	missense	probably benign	0.00
R4225:Abca1	UTSW	4	53085106	missense	possibly damaging	0.87
R4577:Abca1	UTSW	4	53062568	missense	possibly damaging	0.94
R4979:Abca1	UTSW	4	53085092	splice site	probably null
R5022:Abca1	UTSW	4	53041570	frame shift	probably null
R5168:Abca1	UTSW	4	53086070	missense	probably benign
R5363:Abca1	UTSW	4	53132963	missense	probably benign	0.00
R5439:Abca1	UTSW	4	53042381	missense	possibly damaging	0.55
R5604:Abca1	UTSW	4	53067168	splice site	probably null
R5614:Abca1	UTSW	4	53046132	missense	probably damaging	1.00
R5810:Abca1	UTSW	4	53079631	missense	probably benign
R6001:Abca1	UTSW	4	53075555	missense	possibly damaging	0.68
R6151:Abca1	UTSW	4	53085261	missense	probably benign
R6185:Abca1	UTSW	4	53078089	missense	probably benign	0.31
R6262:Abca1	UTSW	4	53092917	missense	probably benign	0.01
R6455:Abca1	UTSW	4	53042376	missense	probably damaging	0.98
R6472:Abca1	UTSW	4	53085991	critical splice donor site	probably null
R6564:Abca1	UTSW	4	53034031	missense	possibly damaging	0.85
R6720:Abca1	UTSW	4	53083733	missense	probably damaging	1.00
R6903:Abca1	UTSW	4	53143952	missense	probably benign	0.17
R6960:Abca1	UTSW	4	53072924	missense	probably benign	0.00
R7065:Abca1	UTSW	4	53074233	missense	probably damaging	0.98
R7142:Abca1	UTSW	4	53082050	missense	probably damaging	1.00
R7322:Abca1	UTSW	4	53067151	missense	probably damaging	0.97
R7520:Abca1	UTSW	4	53078114	missense	probably benign
R7547:Abca1	UTSW	4	53109269	missense	probably benign	0.02
R7793:Abca1	UTSW	4	53042367	missense	not run
R7863:Abca1	UTSW	4	53107179	missense	probably benign
R7877:Abca1	UTSW	4	53046135	missense	possibly damaging	0.55
R8010:Abca1	UTSW	4	53127600	missense	probably benign
R8058:Abca1	UTSW	4	53081954	missense	possibly damaging	0.60
R8181:Abca1	UTSW	4	53059303	missense	probably benign	0.21
R8471:Abca1	UTSW	4	53044187	missense	probably damaging	1.00
R8774:Abca1	UTSW	4	53090358	missense	possibly damaging	0.89
R8774-TAIL:Abca1	UTSW	4	53090358	missense	possibly damaging	0.89
R8806:Abca1	UTSW	4	53084520	missense	probably benign	0.17
R8841:Abca1	UTSW	4	53143925	splice site	probably benign
R9081:Abca1	UTSW	4	53109162	critical splice donor site	probably null
RF005:Abca1	UTSW	4	53049125	missense	probably damaging	0.97
RF024:Abca1	UTSW	4	53049125	missense	probably damaging	0.97
X0023:Abca1	UTSW	4	53049038	missense	possibly damaging	0.91
Z1177:Abca1	UTSW	4	53079584	missense	probably benign	0.00
Z1177:Abca1	UTSW	4	53080799	missense	probably benign	0.01
Z1177:Abca1	UTSW	4	53086133	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- AGTATACGAAACACTGTTGGTCTG -3'
(R):5'- ATCCGGAAATGCCTTGGGAG -3'

Sequencing Primer
(F):5'- GAAACACTGTTGGTCTGTTTCAACC -3'
(R):5'- GAAAGGGGCTTAATTTTCAGTCTCC -3'

Posted On

2015-04-17