Incidental Mutation 'R3906:Kbtbd8'
ID309182
Institutional Source Beutler Lab
Gene Symbol Kbtbd8
Ensembl Gene ENSMUSG00000030031
Gene Namekelch repeat and BTB (POZ) domain containing 8
SynonymsSSEC 51, SSEC51, Takrp, SSEC-51
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location95117240-95129790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95126584 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 405 (Y405N)
Ref Sequence ENSEMBL: ENSMUSP00000113739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032107] [ENSMUST00000119582] [ENSMUST00000122938]
Predicted Effect probably damaging
Transcript: ENSMUST00000032107
AA Change: Y482N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032107
Gene: ENSMUSG00000030031
AA Change: Y482N

DomainStartEndE-ValueType
BTB 49 147 7.37e-28 SMART
BACK 152 254 1.37e-26 SMART
Kelch 334 388 2.63e-3 SMART
Kelch 389 439 6.13e-4 SMART
Kelch 480 530 5.06e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119582
AA Change: Y405N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113739
Gene: ENSMUSG00000030031
AA Change: Y405N

DomainStartEndE-ValueType
Pfam:BTB 1 70 5.1e-14 PFAM
BACK 75 177 1.37e-26 SMART
Kelch 257 311 2.63e-3 SMART
Kelch 312 362 6.13e-4 SMART
Blast:Kelch 364 402 4e-18 BLAST
Kelch 403 453 5.06e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122938
SMART Domains Protein: ENSMUSP00000145009
Gene: ENSMUSG00000030031

DomainStartEndE-ValueType
BTB 65 142 1.4e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145387
Meta Mutation Damage Score 0.9675 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Kbtbd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Kbtbd8 APN 6 95126513 missense probably damaging 1.00
IGL01382:Kbtbd8 APN 6 95122230 missense probably damaging 1.00
IGL01459:Kbtbd8 APN 6 95122808 missense probably benign 0.10
IGL01656:Kbtbd8 APN 6 95118676 missense probably benign 0.02
IGL02100:Kbtbd8 APN 6 95122682 missense probably damaging 1.00
IGL02133:Kbtbd8 APN 6 95121732 splice site probably benign
IGL02532:Kbtbd8 APN 6 95126536 missense probably benign 0.17
IGL02982:Kbtbd8 APN 6 95126566 missense probably benign 0.01
IGL03074:Kbtbd8 APN 6 95122352 missense probably damaging 0.99
R0782:Kbtbd8 UTSW 6 95122232 missense probably damaging 1.00
R2075:Kbtbd8 UTSW 6 95126683 missense possibly damaging 0.47
R2329:Kbtbd8 UTSW 6 95126780 missense probably benign 0.00
R2698:Kbtbd8 UTSW 6 95126589 nonsense probably null
R4276:Kbtbd8 UTSW 6 95126933 missense probably damaging 0.99
R4915:Kbtbd8 UTSW 6 95126534 missense possibly damaging 0.95
R5141:Kbtbd8 UTSW 6 95121839 missense probably damaging 1.00
R5294:Kbtbd8 UTSW 6 95121832 nonsense probably null
R5779:Kbtbd8 UTSW 6 95118534 missense probably benign
R6645:Kbtbd8 UTSW 6 95126749 nonsense probably null
R7073:Kbtbd8 UTSW 6 95121833 missense probably damaging 1.00
R7161:Kbtbd8 UTSW 6 95126696 missense probably benign 0.30
R7600:Kbtbd8 UTSW 6 95122592 missense probably damaging 1.00
R7731:Kbtbd8 UTSW 6 95118578 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCAGGTCATATGTGCCAG -3'
(R):5'- TCACTTGAGTAGCTCGCAC -3'

Sequencing Primer
(F):5'- CCAGTGCATGTTGGCTGTAATATTAC -3'
(R):5'- CTTGAGTAGCTCGCACAAATAAATGG -3'
Posted On2015-04-17