Incidental Mutation 'R3906:Ces2a'
ID309187
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Namecarboxylesterase 2A
SynonymsCes6, 9130231C15Rik
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104734003-104741634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104739308 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 325 (I325V)
Ref Sequence ENSEMBL: ENSMUSP00000127346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
Predicted Effect probably benign
Transcript: ENSMUST00000034346
AA Change: I358V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: I358V

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159303
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect probably benign
Transcript: ENSMUST00000164182
AA Change: I325V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: I325V

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 104741415 makesense probably null
IGL02135:Ces2a APN 8 104740181 missense probably benign 0.00
IGL02529:Ces2a APN 8 104737219 splice site probably benign
IGL02625:Ces2a APN 8 104740278 critical splice donor site probably null
IGL02869:Ces2a APN 8 104739059 missense probably damaging 1.00
IGL03265:Ces2a APN 8 104737443 missense possibly damaging 0.55
IGL03349:Ces2a APN 8 104734080 missense probably damaging 0.99
R0010:Ces2a UTSW 8 104741396 missense probably benign 0.00
R0318:Ces2a UTSW 8 104740824 missense probably damaging 1.00
R0477:Ces2a UTSW 8 104737537 missense probably damaging 0.99
R0561:Ces2a UTSW 8 104737533 missense probably benign 0.35
R0619:Ces2a UTSW 8 104736110 missense probably benign 0.00
R1665:Ces2a UTSW 8 104737555 splice site probably benign
R1737:Ces2a UTSW 8 104740824 missense probably damaging 0.98
R2266:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2267:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2269:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2288:Ces2a UTSW 8 104737437 missense probably damaging 1.00
R2656:Ces2a UTSW 8 104736134 missense probably benign 0.00
R3176:Ces2a UTSW 8 104739378 splice site probably benign
R4344:Ces2a UTSW 8 104737134 missense probably damaging 1.00
R4708:Ces2a UTSW 8 104737306 missense probably benign 0.14
R4780:Ces2a UTSW 8 104737208 missense probably damaging 1.00
R5434:Ces2a UTSW 8 104737409 missense probably damaging 0.98
R5763:Ces2a UTSW 8 104736124 missense probably benign 0.00
R5828:Ces2a UTSW 8 104739324 missense probably benign 0.00
R6359:Ces2a UTSW 8 104736078 missense probably benign 0.00
R6440:Ces2a UTSW 8 104741322 missense probably benign 0.12
R7066:Ces2a UTSW 8 104740248 missense probably damaging 0.99
R7267:Ces2a UTSW 8 104739040 missense probably benign 0.20
R7395:Ces2a UTSW 8 104739641 missense probably benign 0.35
R7455:Ces2a UTSW 8 104737522 missense probably damaging 1.00
R7457:Ces2a UTSW 8 104737389 missense possibly damaging 0.87
R7567:Ces2a UTSW 8 104741298 missense probably benign 0.01
R7683:Ces2a UTSW 8 104737112 missense probably benign 0.00
R8328:Ces2a UTSW 8 104737366 missense probably damaging 1.00
R8336:Ces2a UTSW 8 104739033 missense probably damaging 0.97
X0022:Ces2a UTSW 8 104736142 missense probably damaging 1.00
Z1176:Ces2a UTSW 8 104734006 unclassified probably benign
Z1176:Ces2a UTSW 8 104734850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGAGCTGCTGACCTCTATG -3'
(R):5'- TTGCAGTGATCCCATTCAGG -3'

Sequencing Primer
(F):5'- CAGCATCATTGGTGTCAACAC -3'
(R):5'- TGCAGTGATCCCATTCAGGTACAC -3'
Posted On2015-04-17