Incidental Mutation 'R3906:Gan'
ID309188
Institutional Source Beutler Lab
Gene Symbol Gan
Ensembl Gene ENSMUSG00000052557
Gene Namegiant axonal neuropathy
Synonymsgigaxonin
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location117158135-117215997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117194134 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 370 (V370M)
Ref Sequence ENSEMBL: ENSMUSP00000070168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064488]
Predicted Effect probably damaging
Transcript: ENSMUST00000064488
AA Change: V370M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070168
Gene: ENSMUSG00000052557
AA Change: V370M

DomainStartEndE-ValueType
BTB 30 129 7.1e-21 SMART
BACK 134 236 2.42e-27 SMART
Kelch 274 326 2.23e-1 SMART
Kelch 327 374 3.41e-11 SMART
Kelch 375 421 1.39e-2 SMART
Kelch 422 468 2.23e-6 SMART
Kelch 528 577 2.09e1 SMART
low complexity region 580 591 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162997
AA Change: V369M
SMART Domains Protein: ENSMUSP00000124904
Gene: ENSMUSG00000052557
AA Change: V369M

DomainStartEndE-ValueType
BTB 30 129 7.1e-21 SMART
BACK 134 236 2.42e-27 SMART
Kelch 274 326 2.23e-1 SMART
Kelch 327 374 3.41e-11 SMART
Kelch 375 421 1.39e-2 SMART
Kelch 422 468 2.23e-6 SMART
Kelch 528 577 2.09e1 SMART
low complexity region 580 591 N/A INTRINSIC
Meta Mutation Damage Score 0.7860 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytoskeletal BTB/kelch (Broad-Complex, Tramtrack and Bric a brac) repeat family. The encoded protein plays a role in neurofilament architecture and is involved in mediating the ubiquitination and degradation of some proteins. Defects in this gene are a cause of giant axonal neuropathy (GAN). [provided by RefSeq, Oct 2008]
PHENOTYPE: Null homozygotes display some muscular atrophy and motor neuron degeneration with the severity of these symptoms depending on genotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Gan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Gan APN 8 117193324 missense probably damaging 0.98
IGL01132:Gan APN 8 117196444 splice site probably benign
IGL01622:Gan APN 8 117187178 missense probably damaging 1.00
IGL01623:Gan APN 8 117187178 missense probably damaging 1.00
IGL03093:Gan APN 8 117183575 missense probably benign
R1534:Gan UTSW 8 117187429 missense probably benign 0.04
R1795:Gan UTSW 8 117196460 missense possibly damaging 0.57
R2027:Gan UTSW 8 117187499 critical splice donor site probably null
R2967:Gan UTSW 8 117183526 missense probably damaging 0.98
R4735:Gan UTSW 8 117194231 missense probably damaging 0.98
R5985:Gan UTSW 8 117195818 missense possibly damaging 0.89
R6027:Gan UTSW 8 117158295 missense probably damaging 1.00
R7002:Gan UTSW 8 117195847 missense possibly damaging 0.89
R7133:Gan UTSW 8 117187230 nonsense probably null
R8401:Gan UTSW 8 117183503 missense possibly damaging 0.83
X0023:Gan UTSW 8 117190384 missense probably benign 0.01
Z31818:Gan UTSW 8 117195797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAGCCTGCATCTTTTGTC -3'
(R):5'- CCAGAAAGGGACACTGACTG -3'

Sequencing Primer
(F):5'- AGGAGTGACTAGCTGGCTC -3'
(R):5'- ACTGACGCCAGCTTGTGAAG -3'
Posted On2015-04-17