Incidental Mutation 'R3906:Frk'
ID309190
Institutional Source Beutler Lab
Gene Symbol Frk
Ensembl Gene ENSMUSG00000019779
Gene Namefyn-related kinase
SynonymsGTK, BSK/IYK
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location34483399-34611278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34584056 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 216 (L216V)
Ref Sequence ENSEMBL: ENSMUSP00000130289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019913] [ENSMUST00000170771]
Predicted Effect probably benign
Transcript: ENSMUST00000019913
AA Change: L216V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019913
Gene: ENSMUSG00000019779
AA Change: L216V

DomainStartEndE-ValueType
SH3 52 116 2.76e-19 SMART
SH2 121 206 4.97e-37 SMART
TyrKc 241 494 8.58e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170771
AA Change: L216V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130289
Gene: ENSMUSG00000019779
AA Change: L216V

DomainStartEndE-ValueType
SH3 52 116 2.76e-19 SMART
SH2 121 206 4.97e-37 SMART
TyrKc 241 494 8.58e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215594
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TYR family of protein kinases. This tyrosine kinase is a nuclear protein and may function during G1 and S phase of the cell cycle and suppress growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit increased susceptibility to spontaneous tumors nor increased sensitivity to inoizing radiation. Epithelial tissues appear similar to controls, but circulating levels of T3 were significantly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Frk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Frk APN 10 34484243 missense probably damaging 0.98
IGL01402:Frk APN 10 34547385 missense probably damaging 1.00
IGL02197:Frk APN 10 34484334 missense probably damaging 1.00
IGL02289:Frk APN 10 34484366 missense probably damaging 0.99
IGL02618:Frk APN 10 34583964 missense possibly damaging 0.88
IGL02885:Frk APN 10 34484071 missense probably benign 0.03
IGL03256:Frk APN 10 34607842 missense probably benign 0.00
R0299:Frk UTSW 10 34484371 critical splice donor site probably null
R0697:Frk UTSW 10 34607837 missense probably benign 0.12
R1033:Frk UTSW 10 34608458 missense probably damaging 1.00
R1583:Frk UTSW 10 34591810 critical splice acceptor site probably null
R1793:Frk UTSW 10 34607882 missense probably benign 0.05
R2248:Frk UTSW 10 34608531 missense probably benign 0.10
R3084:Frk UTSW 10 34607954 missense probably damaging 1.00
R3086:Frk UTSW 10 34607954 missense probably damaging 1.00
R3765:Frk UTSW 10 34484005 start codon destroyed probably null 0.98
R3766:Frk UTSW 10 34484005 start codon destroyed probably null 0.98
R4163:Frk UTSW 10 34591872 missense probably damaging 0.98
R4486:Frk UTSW 10 34608381 missense probably benign 0.10
R4591:Frk UTSW 10 34605833 missense probably benign 0.03
R4821:Frk UTSW 10 34484237 missense probably benign 0.01
R5070:Frk UTSW 10 34484284 nonsense probably null
R6172:Frk UTSW 10 34591965 missense probably damaging 1.00
R6572:Frk UTSW 10 34583967 missense probably benign 0.00
R6619:Frk UTSW 10 34605839 missense probably benign 0.22
R7307:Frk UTSW 10 34591938 missense probably damaging 1.00
R7486:Frk UTSW 10 34547296 nonsense probably null
R7916:Frk UTSW 10 34484025 missense possibly damaging 0.74
R8341:Frk UTSW 10 34586283 missense probably damaging 1.00
Z1177:Frk UTSW 10 34584005 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACGCCTTTATTGACAGGATTTG -3'
(R):5'- GATAGTAAAGGAATCAGTGCATCTC -3'

Sequencing Primer
(F):5'- CGCCTTTATTGACAGGATTTGTTTTG -3'
(R):5'- CTCCTGCTCTAAGTAAGCA -3'
Posted On2015-04-17