Incidental Mutation 'R3906:Lasp1'
ID309192
Institutional Source Beutler Lab
Gene Symbol Lasp1
Ensembl Gene ENSMUSG00000038366
Gene NameLIM and SH3 protein 1
SynonymsTg(Col1a1-lacZ)1Ngma, Def-4, Tg(11Col1a1)NG, SH3P6
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location97799000-97838764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97799827 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 12 (V12M)
Ref Sequence ENSEMBL: ENSMUSP00000116102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043843] [ENSMUST00000127033] [ENSMUST00000129558] [ENSMUST00000129828] [ENSMUST00000134428] [ENSMUST00000136723] [ENSMUST00000143571] [ENSMUST00000146572] [ENSMUST00000152962]
Predicted Effect probably damaging
Transcript: ENSMUST00000043843
AA Change: V12M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042123
Gene: ENSMUSG00000038366
AA Change: V12M

DomainStartEndE-ValueType
LIM 4 56 4.34e-15 SMART
NEBU 62 92 1.1e-8 SMART
NEBU 98 128 1.05e-9 SMART
low complexity region 174 180 N/A INTRINSIC
SH3 207 263 8.11e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107569
Predicted Effect probably benign
Transcript: ENSMUST00000127033
SMART Domains Protein: ENSMUSP00000127792
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
Pfam:Nebulin 31 59 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129558
SMART Domains Protein: ENSMUSP00000123165
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129828
SMART Domains Protein: ENSMUSP00000115308
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134428
Predicted Effect probably benign
Transcript: ENSMUST00000136723
SMART Domains Protein: ENSMUSP00000114306
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
Pfam:Nebulin 31 59 1.2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143571
AA Change: V12M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000146572
SMART Domains Protein: ENSMUSP00000121907
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
Pfam:Nebulin 31 59 2.1e-12 PFAM
Pfam:Nebulin 67 89 1.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152962
SMART Domains Protein: ENSMUSP00000120645
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Meta Mutation Damage Score 0.8629 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM proteins, characterized by a LIM motif and a domain of Src homology region 3, and also a member of the nebulin family of actin-binding proteins. The encoded protein is a cAMP and cGMP dependent signaling protein and binds to the actin cytoskeleton at extensions of the cell membrane. The encoded protein has been linked to metastatic breast cancer, hematopoetic tumors such as B-cell lymphomas, and colorectal cancer. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced histamine-stimulated gastric acid secretion and enlarged heart and testes on a mixed background. Mice homozygous for a transgene insertion exhibit abnormal tail vertebrae with scoliosis, transient spina bifida occulta, and a bent tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Lasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Lasp1 APN 11 97836190 missense probably damaging 1.00
R0281:Lasp1 UTSW 11 97806851 nonsense probably null
R2126:Lasp1 UTSW 11 97836134 missense probably benign 0.34
R3908:Lasp1 UTSW 11 97799827 missense probably damaging 1.00
R3909:Lasp1 UTSW 11 97799827 missense probably damaging 1.00
R4908:Lasp1 UTSW 11 97833704 critical splice donor site probably null
R5239:Lasp1 UTSW 11 97799860 missense probably damaging 1.00
R6519:Lasp1 UTSW 11 97815557 splice site probably null
R6576:Lasp1 UTSW 11 97833576 missense probably damaging 1.00
R6629:Lasp1 UTSW 11 97806896 nonsense probably null
R7001:Lasp1 UTSW 11 97806833 missense probably damaging 1.00
R8063:Lasp1 UTSW 11 97834131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCCACTGTGTTTATTAGGGGAAG -3'
(R):5'- TAACCTCGATGCACAGAGGC -3'

Sequencing Primer
(F):5'- CACTGTGTTTATTAGGGGAAGGAGGG -3'
(R):5'- TCCCAGGTTCCAGACTGG -3'
Posted On2015-04-17