Incidental Mutation 'R3906:Kif26a'
ID309196
Institutional Source Beutler Lab
Gene Symbol Kif26a
Ensembl Gene ENSMUSG00000021294
Gene Namekinesin family member 26A
SynonymsN-11 kinesin
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R3906 (G1)
Quality Score167
Status Validated
Chromosome12
Chromosomal Location112146208-112181747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112176890 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1193 (S1193T)
Ref Sequence ENSEMBL: ENSMUSP00000119482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128402]
Predicted Effect probably benign
Transcript: ENSMUST00000128402
AA Change: S1193T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119482
Gene: ENSMUSG00000021294
AA Change: S1193T

DomainStartEndE-ValueType
low complexity region 238 248 N/A INTRINSIC
low complexity region 279 297 N/A INTRINSIC
KISc 362 726 9.57e-35 SMART
low complexity region 727 739 N/A INTRINSIC
low complexity region 740 754 N/A INTRINSIC
low complexity region 932 957 N/A INTRINSIC
low complexity region 1005 1012 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1084 1095 N/A INTRINSIC
low complexity region 1328 1360 N/A INTRINSIC
low complexity region 1458 1471 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1519 1538 N/A INTRINSIC
low complexity region 1574 1587 N/A INTRINSIC
low complexity region 1664 1675 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
coiled coil region 1780 1812 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183816
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death associated with megacolon and hyperganglionosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Kif26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Kif26a APN 12 112157632 missense probably damaging 0.97
IGL01734:Kif26a APN 12 112176828 missense probably benign 0.23
IGL01916:Kif26a APN 12 112176894 missense possibly damaging 0.49
IGL02080:Kif26a APN 12 112157566 missense probably damaging 1.00
IGL02138:Kif26a APN 12 112174850 missense probably damaging 1.00
IGL02145:Kif26a APN 12 112176975 missense probably benign 0.00
IGL02285:Kif26a APN 12 112157507 missense probably damaging 1.00
IGL02393:Kif26a APN 12 112172664 missense probably damaging 1.00
IGL02445:Kif26a APN 12 112173743 missense probably damaging 1.00
IGL02865:Kif26a APN 12 112177615 nonsense probably null
IGL03057:Kif26a APN 12 112175774 nonsense probably null
IGL03204:Kif26a APN 12 112174779 missense probably damaging 1.00
R0013:Kif26a UTSW 12 112177880 missense probably benign 0.03
R0034:Kif26a UTSW 12 112168963 splice site probably benign
R0089:Kif26a UTSW 12 112177403 missense probably damaging 0.98
R0111:Kif26a UTSW 12 112163337 splice site probably benign
R0220:Kif26a UTSW 12 112157390 missense probably damaging 0.98
R0346:Kif26a UTSW 12 112179348 missense probably null 0.09
R0383:Kif26a UTSW 12 112178076 missense possibly damaging 0.94
R0478:Kif26a UTSW 12 112175789 missense probably damaging 1.00
R0494:Kif26a UTSW 12 112179471 splice site probably null
R1163:Kif26a UTSW 12 112179945 missense probably benign 0.08
R1450:Kif26a UTSW 12 112173852 missense probably damaging 1.00
R1512:Kif26a UTSW 12 112146955 missense possibly damaging 0.47
R1616:Kif26a UTSW 12 112157246 critical splice acceptor site probably null
R1723:Kif26a UTSW 12 112173858 missense possibly damaging 0.67
R1728:Kif26a UTSW 12 112176785 missense possibly damaging 0.95
R1729:Kif26a UTSW 12 112176785 missense possibly damaging 0.95
R1903:Kif26a UTSW 12 112175540 missense probably damaging 1.00
R2283:Kif26a UTSW 12 112177353 missense possibly damaging 0.66
R3862:Kif26a UTSW 12 112179889 missense probably benign 0.30
R4050:Kif26a UTSW 12 112179916 missense probably benign 0.08
R4270:Kif26a UTSW 12 112173414 missense probably damaging 1.00
R4271:Kif26a UTSW 12 112173414 missense probably damaging 1.00
R4731:Kif26a UTSW 12 112175573 missense probably benign
R4732:Kif26a UTSW 12 112175573 missense probably benign
R4733:Kif26a UTSW 12 112175573 missense probably benign
R4908:Kif26a UTSW 12 112157342 missense probably damaging 1.00
R4946:Kif26a UTSW 12 112177794 missense probably damaging 0.99
R5566:Kif26a UTSW 12 112157354 missense probably damaging 1.00
R6280:Kif26a UTSW 12 112174869 missense probably damaging 0.99
R6422:Kif26a UTSW 12 112168875 missense possibly damaging 0.95
R6513:Kif26a UTSW 12 112175492 missense probably damaging 0.97
R6860:Kif26a UTSW 12 112146829 missense probably damaging 1.00
R6879:Kif26a UTSW 12 112177653 missense probably benign
R7127:Kif26a UTSW 12 112178145 missense probably damaging 1.00
R7366:Kif26a UTSW 12 112163542 critical splice donor site probably null
R7595:Kif26a UTSW 12 112179325 missense probably benign 0.30
R7630:Kif26a UTSW 12 112175697 missense probably damaging 1.00
R7784:Kif26a UTSW 12 112178147 missense possibly damaging 0.66
X0027:Kif26a UTSW 12 112176070 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTTGTCTGAAAGCCGTGGTC -3'
(R):5'- TCTGAGTCTCAGGCAATCGAGG -3'

Sequencing Primer
(F):5'- TGAAAGCCGTGGTCCCACAC -3'
(R):5'- TCTGCCCGTAGAGGCTATCTG -3'
Posted On2015-04-17