Mutagenetix > Incidental Mutations

Incidental Mutation 'R3906:Kif26a'

309196

Institutional Source

Beutler Lab

Gene Symbol

Kif26a

Ensembl Gene

ENSMUSG00000021294

Gene Name

kinesin family member 26A

Synonyms

N-11 kinesin

MMRRC Submission

040813-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.831) question?

Stock #

R3906 (G1)

Quality Score

167

Status

Validated

Chromosome

Chromosomal Location

112146208-112181747 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 112176890 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1193 (S1193T)

Ref Sequence

ENSEMBL: ENSMUSP00000119482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128402]

Predicted Effect

probably benign
Transcript: ENSMUST00000128402
AA Change: S1193T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119482
Gene: ENSMUSG00000021294
AA Change: S1193T

Domain	Start	End	E-Value	Type
low complexity region	238	248	N/A	INTRINSIC
low complexity region	279	297	N/A	INTRINSIC
KISc	362	726	9.57e-35	SMART
low complexity region	727	739	N/A	INTRINSIC
low complexity region	740	754	N/A	INTRINSIC
low complexity region	932	957	N/A	INTRINSIC
low complexity region	1005	1012	N/A	INTRINSIC
low complexity region	1044	1054	N/A	INTRINSIC
low complexity region	1084	1095	N/A	INTRINSIC
low complexity region	1328	1360	N/A	INTRINSIC
low complexity region	1458	1471	N/A	INTRINSIC
low complexity region	1477	1493	N/A	INTRINSIC
low complexity region	1519	1538	N/A	INTRINSIC
low complexity region	1574	1587	N/A	INTRINSIC
low complexity region	1664	1675	N/A	INTRINSIC
low complexity region	1699	1713	N/A	INTRINSIC
coiled coil region	1780	1812	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183816

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death associated with megacolon and hyperganglionosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,067,151	V1352A	possibly damaging	Het
Abcb7	G	T	X: 104,284,159	Q715K	probably benign	Het
Adamts3	C	A	5: 89,861,355	G150C	probably damaging	Het
Ank2	A	G	3: 127,016,898	L513P	probably damaging	Het
Cacng1	C	A	11: 107,716,292	V34L	probably benign	Het
Cd1d1	A	G	3: 86,998,756	W71R	probably damaging	Het
Cdhr3	A	G	12: 33,053,428	F397L	probably damaging	Het
Ces2a	A	G	8: 104,739,308	I325V	probably benign	Het
Ctsq	C	T	13: 61,038,771	V140M	probably damaging	Het
Cyp4f18	A	G	8: 72,001,082		probably benign	Het
Ddi2	T	C	4: 141,684,281	D440G	probably benign	Het
Dsg3	G	A	18: 20,538,499	G754R	probably damaging	Het
Endod1	T	A	9: 14,380,855	Y39F	probably benign	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Fn1	C	T	1: 71,607,913	G1482R	probably damaging	Het
Fpr2	A	G	17: 17,893,549	K269R	probably benign	Het
Frk	T	G	10: 34,584,056	L216V	probably benign	Het
Gan	G	A	8: 117,194,134	V370M	probably damaging	Het
Grik1	A	G	16: 88,006,449	I285T	probably benign	Het
Hspa1a	C	T	17: 34,971,727	V67M	probably damaging	Het
Kbtbd8	T	A	6: 95,126,584	Y405N	probably damaging	Het
Kcnj4	G	T	15: 79,485,745	H11Q	probably benign	Het
Kmt2e	A	G	5: 23,501,626	N1396D	probably benign	Het
Lasp1	G	A	11: 97,799,827	V12M	probably damaging	Het
Lrrk1	G	T	7: 66,294,903	T653K	possibly damaging	Het
Meiob	A	G	17: 24,827,948	Y182C	probably benign	Het
Myh6	T	C	14: 54,956,955	D739G	probably benign	Het
Ninl	T	C	2: 150,980,119	D21G	probably damaging	Het
Olfr1504	C	T	19: 13,887,706	C168Y	probably damaging	Het
Olfr743	C	T	14: 50,533,754	T114I	probably benign	Het
Pacsin2	A	C	15: 83,379,055	V125G	probably damaging	Het
Pfas	G	A	11: 68,988,286		probably benign	Het
Pla2g4f	C	T	2: 120,300,499	R825Q	probably benign	Het
Prkd1	A	T	12: 50,388,426	V506E	possibly damaging	Het
Psmd2	A	G	16: 20,655,642	D316G	probably benign	Het
Ryr2	T	A	13: 11,738,209	D1742V	possibly damaging	Het
Szt2	G	A	4: 118,378,269		probably benign	Het
Ugt8a	T	C	3: 125,914,982	T160A	possibly damaging	Het
Xrcc6	A	G	15: 82,029,571	T378A	probably benign	Het

Other mutations in Kif26a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Kif26a	APN	12	112157632	missense	probably damaging	0.97
IGL01734:Kif26a	APN	12	112176828	missense	probably benign	0.23
IGL01916:Kif26a	APN	12	112176894	missense	possibly damaging	0.49
IGL02080:Kif26a	APN	12	112157566	missense	probably damaging	1.00
IGL02138:Kif26a	APN	12	112174850	missense	probably damaging	1.00
IGL02145:Kif26a	APN	12	112176975	missense	probably benign	0.00
IGL02285:Kif26a	APN	12	112157507	missense	probably damaging	1.00
IGL02393:Kif26a	APN	12	112172664	missense	probably damaging	1.00
IGL02445:Kif26a	APN	12	112173743	missense	probably damaging	1.00
IGL02865:Kif26a	APN	12	112177615	nonsense	probably null
IGL03057:Kif26a	APN	12	112175774	nonsense	probably null
IGL03204:Kif26a	APN	12	112174779	missense	probably damaging	1.00
R0013:Kif26a	UTSW	12	112177880	missense	probably benign	0.03
R0034:Kif26a	UTSW	12	112168963	splice site	probably benign
R0089:Kif26a	UTSW	12	112177403	missense	probably damaging	0.98
R0111:Kif26a	UTSW	12	112163337	splice site	probably benign
R0220:Kif26a	UTSW	12	112157390	missense	probably damaging	0.98
R0346:Kif26a	UTSW	12	112179348	missense	probably null	0.09
R0383:Kif26a	UTSW	12	112178076	missense	possibly damaging	0.94
R0478:Kif26a	UTSW	12	112175789	missense	probably damaging	1.00
R0494:Kif26a	UTSW	12	112179471	splice site	probably null
R1163:Kif26a	UTSW	12	112179945	missense	probably benign	0.08
R1450:Kif26a	UTSW	12	112173852	missense	probably damaging	1.00
R1512:Kif26a	UTSW	12	112146955	missense	possibly damaging	0.47
R1616:Kif26a	UTSW	12	112157246	critical splice acceptor site	probably null
R1723:Kif26a	UTSW	12	112173858	missense	possibly damaging	0.67
R1728:Kif26a	UTSW	12	112176785	missense	possibly damaging	0.95
R1729:Kif26a	UTSW	12	112176785	missense	possibly damaging	0.95
R1903:Kif26a	UTSW	12	112175540	missense	probably damaging	1.00
R2283:Kif26a	UTSW	12	112177353	missense	possibly damaging	0.66
R3862:Kif26a	UTSW	12	112179889	missense	probably benign	0.30
R4050:Kif26a	UTSW	12	112179916	missense	probably benign	0.08
R4270:Kif26a	UTSW	12	112173414	missense	probably damaging	1.00
R4271:Kif26a	UTSW	12	112173414	missense	probably damaging	1.00
R4731:Kif26a	UTSW	12	112175573	missense	probably benign
R4732:Kif26a	UTSW	12	112175573	missense	probably benign
R4733:Kif26a	UTSW	12	112175573	missense	probably benign
R4908:Kif26a	UTSW	12	112157342	missense	probably damaging	1.00
R4946:Kif26a	UTSW	12	112177794	missense	probably damaging	0.99
R5566:Kif26a	UTSW	12	112157354	missense	probably damaging	1.00
R6280:Kif26a	UTSW	12	112174869	missense	probably damaging	0.99
R6422:Kif26a	UTSW	12	112168875	missense	possibly damaging	0.95
R6513:Kif26a	UTSW	12	112175492	missense	probably damaging	0.97
R6860:Kif26a	UTSW	12	112146829	missense	probably damaging	1.00
R6879:Kif26a	UTSW	12	112177653	missense	probably benign
R7127:Kif26a	UTSW	12	112178145	missense	probably damaging	1.00
R7366:Kif26a	UTSW	12	112163542	critical splice donor site	probably null
R7595:Kif26a	UTSW	12	112179325	missense	probably benign	0.30
R7630:Kif26a	UTSW	12	112175697	missense	probably damaging	1.00
R7784:Kif26a	UTSW	12	112178147	missense	possibly damaging	0.66
X0027:Kif26a	UTSW	12	112176070	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- CTTGTCTGAAAGCCGTGGTC -3'
(R):5'- TCTGAGTCTCAGGCAATCGAGG -3'

Sequencing Primer
(F):5'- TGAAAGCCGTGGTCCCACAC -3'
(R):5'- TCTGCCCGTAGAGGCTATCTG -3'

Posted On

2015-04-17