Incidental Mutation 'R3906:Ctsq'
ID309198
Institutional Source Beutler Lab
Gene Symbol Ctsq
Ensembl Gene ENSMUSG00000021439
Gene Namecathepsin Q
Synonyms1600010J02Rik
MMRRC Submission 040813-MU
Accession Numbers

Ncbi RefSeq: NM_029636.3; MGI:2137385

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3906 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location61035024-61040631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61038771 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 140 (V140M)
Ref Sequence ENSEMBL: ENSMUSP00000021888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021888]
Predicted Effect probably damaging
Transcript: ENSMUST00000021888
AA Change: V140M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021888
Gene: ENSMUSG00000021439
AA Change: V140M

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.76e-24 SMART
Pept_C1 125 342 3.46e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144401
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Ctsq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Ctsq APN 13 61037714 missense probably damaging 0.96
IGL00585:Ctsq APN 13 61037127 missense probably benign 0.00
IGL00743:Ctsq APN 13 61036184 missense probably damaging 1.00
IGL00897:Ctsq APN 13 61037725 missense probably damaging 1.00
IGL01679:Ctsq APN 13 61038908 missense probably benign 0.00
IGL01982:Ctsq APN 13 61038918 missense probably benign
IGL01982:Ctsq APN 13 61039521 missense probably benign 0.05
IGL02448:Ctsq APN 13 61036230 missense probably damaging 1.00
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0741:Ctsq UTSW 13 61036205 missense probably damaging 0.99
R1192:Ctsq UTSW 13 61039045 missense probably damaging 1.00
R1593:Ctsq UTSW 13 61036172 splice site probably null
R4483:Ctsq UTSW 13 61038912 missense probably benign 0.01
R4590:Ctsq UTSW 13 61036214 missense probably benign 0.17
R5157:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5365:Ctsq UTSW 13 61037818 missense possibly damaging 0.95
R5366:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5546:Ctsq UTSW 13 61037888 nonsense probably null
R5595:Ctsq UTSW 13 61037060 missense probably benign 0.41
R6046:Ctsq UTSW 13 61039141 missense probably benign 0.00
R6049:Ctsq UTSW 13 61038758 critical splice donor site probably null
R6535:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R6537:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R7159:Ctsq UTSW 13 61038923 missense probably benign 0.00
R8189:Ctsq UTSW 13 61037155 missense probably damaging 1.00
Z1176:Ctsq UTSW 13 61037123 missense probably benign 0.01
Z1177:Ctsq UTSW 13 61037096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCATGTGGTTTAAGAAGATGAGC -3'
(R):5'- ACTTTTCCTTGAAGACTGATGAAG -3'

Sequencing Primer
(F):5'- ACACAGGCAGATCTCTGTGGATTC -3'
(R):5'- TTCCTTGAAGACTGATGAAGAATTC -3'
Posted On2015-04-17