Incidental Mutation 'R3906:Olfr743'
ID309199
Institutional Source Beutler Lab
Gene Symbol Olfr743
Ensembl Gene ENSMUSG00000094285
Gene Nameolfactory receptor 743
SynonymsOlfr264, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, MOR106-14, Olfr265, Olfr743-ps1
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50521839-50534955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50533754 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 114 (T114I)
Ref Sequence ENSEMBL: ENSMUSP00000150946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071294] [ENSMUST00000215793]
Predicted Effect probably benign
Transcript: ENSMUST00000071294
AA Change: T114I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000071263
Gene: ENSMUSG00000094285
AA Change: T114I

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.6e-56 PFAM
Pfam:7tm_1 45 294 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215793
AA Change: T114I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.3994 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Olfr743
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Olfr743 APN 14 50533949 missense probably damaging 1.00
IGL01551:Olfr743 APN 14 50534161 missense probably benign
IGL02024:Olfr743 APN 14 50533850 missense probably benign 0.00
IGL02867:Olfr743 APN 14 50533513 missense probably benign
IGL02889:Olfr743 APN 14 50533513 missense probably benign
IGL03195:Olfr743 APN 14 50533420 missense probably benign
IGL03296:Olfr743 APN 14 50533945 missense possibly damaging 0.90
R0049:Olfr743 UTSW 14 50533694 missense probably damaging 1.00
R0049:Olfr743 UTSW 14 50533694 missense probably damaging 1.00
R0102:Olfr743 UTSW 14 50533631 missense probably damaging 1.00
R0556:Olfr743 UTSW 14 50533924 missense probably benign 0.01
R0626:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0661:Olfr743 UTSW 14 50534095 missense probably benign
R0759:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0761:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0894:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1109:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1110:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1312:Olfr743 UTSW 14 50534195 missense probably benign
R1446:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1470:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1470:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1502:Olfr743 UTSW 14 50533777 missense possibly damaging 0.47
R1518:Olfr743 UTSW 14 50534165 missense probably damaging 1.00
R1529:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1624:Olfr743 UTSW 14 50533643 missense probably damaging 1.00
R1646:Olfr743 UTSW 14 50533583 missense probably benign 0.01
R1687:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1795:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R2011:Olfr743 UTSW 14 50533684 missense probably damaging 1.00
R2120:Olfr743 UTSW 14 50533946 missense probably damaging 1.00
R2697:Olfr743 UTSW 14 50533781 missense probably damaging 1.00
R2857:Olfr743 UTSW 14 50533440 missense probably benign 0.19
R2858:Olfr743 UTSW 14 50533440 missense probably benign 0.19
R4327:Olfr743 UTSW 14 50533514 missense probably benign 0.05
R4355:Olfr743 UTSW 14 50533759 missense possibly damaging 0.94
R4663:Olfr743 UTSW 14 50533604 missense probably damaging 1.00
R5214:Olfr743 UTSW 14 50534347 makesense probably null
R5964:Olfr743 UTSW 14 50534198 missense probably damaging 0.99
R6148:Olfr743 UTSW 14 50534321 missense probably benign 0.00
R6167:Olfr743 UTSW 14 50534155 missense probably damaging 1.00
R6301:Olfr743 UTSW 14 50534254 missense probably benign 0.02
R6616:Olfr743 UTSW 14 50533907 missense probably benign 0.43
R6910:Olfr743 UTSW 14 50533873 missense probably benign 0.31
R7076:Olfr743 UTSW 14 50533821 nonsense probably null
R7483:Olfr743 UTSW 14 50534015 missense probably benign 0.06
R7574:Olfr743 UTSW 14 50534313 missense probably benign 0.01
R7731:Olfr743 UTSW 14 50533684 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGATCAGAGACTCCACACC -3'
(R):5'- AAAGAGGACCTGGGTCACAC -3'

Sequencing Primer
(F):5'- ACACCCCCATGTACCTCCTG -3'
(R):5'- GTGGTCTATAATTCTGGACCCACAG -3'
Posted On2015-04-17