Incidental Mutation 'R3906:Kcnj4'
ID309201
Institutional Source Beutler Lab
Gene Symbol Kcnj4
Ensembl Gene ENSMUSG00000044216
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 4
SynonymsMB-IRK3, Kir 2.3, Kcnf2, IRK3
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79483714-79505241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 79485745 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 11 (H11Q)
Ref Sequence ENSEMBL: ENSMUSP00000094075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057801]
Predicted Effect probably benign
Transcript: ENSMUST00000057801
AA Change: H11Q

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000094075
Gene: ENSMUSG00000044216
AA Change: H11Q

DomainStartEndE-ValueType
Pfam:IRK 22 361 2.1e-155 PFAM
coiled coil region 371 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229365
Meta Mutation Damage Score 0.0698 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Several different potassium channels are known to be involved with electrical signaling in the nervous system. One class is activated by depolarization whereas a second class is not. The latter are referred to as inwardly rectifying K+ channels, and they have a greater tendency to allow potassium to flow into the cell rather than out of it. This asymmetry in potassium ion conductance plays a key role in the excitability of muscle cells and neurons. The protein encoded by this gene is an integral membrane protein and member of the inward rectifier potassium channel family. The encoded protein has a small unitary conductance compared to other members of this protein family. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Kcnj4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Kcnj4 APN 15 79484579 missense probably benign 0.01
IGL02263:Kcnj4 APN 15 79485787 utr 5 prime probably benign
IGL02551:Kcnj4 APN 15 79484902 missense probably benign 0.05
R1305:Kcnj4 UTSW 15 79484819 missense probably damaging 1.00
R1464:Kcnj4 UTSW 15 79485404 missense probably damaging 1.00
R1464:Kcnj4 UTSW 15 79485404 missense probably damaging 1.00
R1475:Kcnj4 UTSW 15 79484630 missense probably damaging 1.00
R1844:Kcnj4 UTSW 15 79485015 missense probably damaging 1.00
R3907:Kcnj4 UTSW 15 79485745 missense probably benign 0.01
R3908:Kcnj4 UTSW 15 79485745 missense probably benign 0.01
R4396:Kcnj4 UTSW 15 79484673 missense probably benign 0.06
R7598:Kcnj4 UTSW 15 79485764 missense probably benign 0.00
R8059:Kcnj4 UTSW 15 79484802 missense probably benign
R8371:Kcnj4 UTSW 15 79485141 missense probably damaging 1.00
X0062:Kcnj4 UTSW 15 79485690 missense probably benign 0.06
Z1177:Kcnj4 UTSW 15 79485169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGTCACCATGGAAGAAG -3'
(R):5'- AGTCTTGAGGTCTCATGTAGGC -3'

Sequencing Primer
(F):5'- TCACCATGGAAGAAGGCAATGC -3'
(R):5'- AGGCTTTTCTGGTCCTGAGAGTC -3'
Posted On2015-04-17