Incidental Mutation 'R3906:Xrcc6'
ID309202
Institutional Source Beutler Lab
Gene Symbol Xrcc6
Ensembl Gene ENSMUSG00000022471
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 6
SynonymsKu p70, G22p1, Ku70
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81987835-82040085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82029571 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 378 (T378A)
Ref Sequence ENSEMBL: ENSMUSP00000097968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069530] [ENSMUST00000100399] [ENSMUST00000164779] [ENSMUST00000170630] [ENSMUST00000230729]
Predicted Effect probably benign
Transcript: ENSMUST00000069530
AA Change: T378A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000068559
Gene: ENSMUSG00000022471
AA Change: T378A

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
VWA 32 246 1.79e0 SMART
Ku78 306 452 2.91e-56 SMART
Pfam:Ku_C 467 557 5e-34 PFAM
SAP 571 605 2.38e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100399
AA Change: T378A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000097968
Gene: ENSMUSG00000022471
AA Change: T378A

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
VWA 32 246 1.79e0 SMART
Ku78 306 452 2.91e-56 SMART
Pfam:Ku_C 470 555 3.1e-31 PFAM
SAP 571 605 2.38e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164775
Predicted Effect probably benign
Transcript: ENSMUST00000164779
SMART Domains Protein: ENSMUSP00000127927
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
Pfam:Ku_N 1 96 4.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170630
SMART Domains Protein: ENSMUSP00000126245
Gene: ENSMUSG00000022471

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Ku_N 35 205 1.2e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170907
Predicted Effect probably benign
Transcript: ENSMUST00000230729
AA Change: T33A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The p70/p80 autoantigen is a nuclear complex consisting of two subunits with molecular masses of approximately 70 and 80 kDa. The complex functions as a single-stranded DNA-dependent ATP-dependent helicase. The complex may be involved in the repair of nonhomologous DNA ends such as that required for double-strand break repair, transposition, and V(D)J recombination. High levels of autoantibodies to p70 and p80 have been found in some patients with systemic lupus erythematosus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuron apoptosis, decreased body size, abnormal B and T cell morphology, increased incidence of tumorigenesis, and increased cellular sensitivity to irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Other mutations in Xrcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Xrcc6 APN 15 82017200 critical splice donor site probably null
IGL01394:Xrcc6 APN 15 82025661 missense possibly damaging 0.69
IGL01648:Xrcc6 APN 15 82025634 missense probably damaging 0.96
R0312:Xrcc6 UTSW 15 82027222 splice site probably null
R0522:Xrcc6 UTSW 15 82022592 splice site probably benign
R1172:Xrcc6 UTSW 15 82031163 missense probably damaging 1.00
R1173:Xrcc6 UTSW 15 82031163 missense probably damaging 1.00
R1218:Xrcc6 UTSW 15 82022941 missense probably benign 0.00
R1269:Xrcc6 UTSW 15 82022847 missense possibly damaging 0.49
R1677:Xrcc6 UTSW 15 82029699 missense probably benign
R2049:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R2140:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R2142:Xrcc6 UTSW 15 82022977 missense probably damaging 1.00
R3737:Xrcc6 UTSW 15 82029631 missense probably damaging 1.00
R3870:Xrcc6 UTSW 15 82025684 missense probably benign 0.16
R4197:Xrcc6 UTSW 15 82029224 missense probably benign 0.06
R4589:Xrcc6 UTSW 15 82022460 missense probably damaging 1.00
R4941:Xrcc6 UTSW 15 82039812 missense probably damaging 1.00
R5318:Xrcc6 UTSW 15 82037507 missense probably damaging 1.00
R5356:Xrcc6 UTSW 15 82029218 missense probably benign 0.00
R5576:Xrcc6 UTSW 15 82022492 missense probably damaging 1.00
R6157:Xrcc6 UTSW 15 82029104 splice site probably null
R6596:Xrcc6 UTSW 15 82022954 start codon destroyed probably null 0.58
R6904:Xrcc6 UTSW 15 82029122 missense probably benign 0.19
R6970:Xrcc6 UTSW 15 82031174 missense probably benign 0.03
R7098:Xrcc6 UTSW 15 82035754 nonsense probably null
R7213:Xrcc6 UTSW 15 82016826 intron probably benign
R7642:Xrcc6 UTSW 15 82016477 critical splice donor site probably null
R7845:Xrcc6 UTSW 15 82016477 critical splice donor site probably null
R8105:Xrcc6 UTSW 15 82031151 missense probably damaging 1.00
R8297:Xrcc6 UTSW 15 82029262 missense probably damaging 1.00
X0063:Xrcc6 UTSW 15 82022493 missense possibly damaging 0.92
Z1176:Xrcc6 UTSW 15 82029213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTCAAGGGACAGCCAGC -3'
(R):5'- TTGATGCTAGGGGACTCAGG -3'

Sequencing Primer
(F):5'- CGCCTGTCACTGGGTTTG -3'
(R):5'- GACTCAGGTGCTTCAGGAC -3'
Posted On2015-04-17