Incidental Mutation 'R3906:Pacsin2'
ID309203
Institutional Source Beutler Lab
Gene Symbol Pacsin2
Ensembl Gene ENSMUSG00000016664
Gene Nameprotein kinase C and casein kinase substrate in neurons 2
SynonymsSyndapin II
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83375607-83464606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 83379055 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 125 (V125G)
Ref Sequence ENSEMBL: ENSMUSP00000155925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056177] [ENSMUST00000165095] [ENSMUST00000171436] [ENSMUST00000230679] [ENSMUST00000231184] [ENSMUST00000231946]
Predicted Effect probably damaging
Transcript: ENSMUST00000056177
AA Change: V431G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058320
Gene: ENSMUSG00000016664
AA Change: V431G

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165095
AA Change: V431G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130098
Gene: ENSMUSG00000016664
AA Change: V431G

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171436
AA Change: V431G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131504
Gene: ENSMUSG00000016664
AA Change: V431G

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000230030
AA Change: V216G
Predicted Effect probably damaging
Transcript: ENSMUST00000230679
AA Change: V431G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231043
Predicted Effect probably damaging
Transcript: ENSMUST00000231184
AA Change: V431G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000231946
AA Change: V125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6794 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation by regulating tubulin polymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Fpr2 A G 17: 17,893,549 K269R probably benign Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Pacsin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Pacsin2 APN 15 83386686 missense probably damaging 1.00
IGL02574:Pacsin2 APN 15 83388663 missense possibly damaging 0.81
R0153:Pacsin2 UTSW 15 83377661 missense probably benign 0.11
R0399:Pacsin2 UTSW 15 83386782 missense probably damaging 1.00
R0426:Pacsin2 UTSW 15 83379795 missense possibly damaging 0.90
R0799:Pacsin2 UTSW 15 83379797 missense probably benign 0.44
R0842:Pacsin2 UTSW 15 83379181 missense probably damaging 0.99
R1591:Pacsin2 UTSW 15 83385051 missense probably damaging 1.00
R2406:Pacsin2 UTSW 15 83385112 unclassified probably benign
R4686:Pacsin2 UTSW 15 83381775 missense probably benign 0.01
R4815:Pacsin2 UTSW 15 83385059 missense probably damaging 1.00
R5849:Pacsin2 UTSW 15 83390518 missense possibly damaging 0.87
R6010:Pacsin2 UTSW 15 83381819 missense possibly damaging 0.87
R6152:Pacsin2 UTSW 15 83377699 missense probably damaging 1.00
R6367:Pacsin2 UTSW 15 83381832 missense probably benign
R6457:Pacsin2 UTSW 15 83379678 splice site probably null
R7158:Pacsin2 UTSW 15 83379742 missense possibly damaging 0.50
R7220:Pacsin2 UTSW 15 83385059 missense probably damaging 1.00
R8089:Pacsin2 UTSW 15 83379696 missense probably benign
X0027:Pacsin2 UTSW 15 83392602 missense probably benign 0.06
Z1177:Pacsin2 UTSW 15 83402001 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCACACTGCCATCTTCCTG -3'
(R):5'- TAAGAGCCTCATGTCACCCC -3'

Sequencing Primer
(F):5'- ACATGCAAAACCTGGTACGG -3'
(R):5'- CCTGTTGCAGTGTCAGCAG -3'
Posted On2015-04-17