Incidental Mutation 'R3906:Fpr2'
ID309206
Institutional Source Beutler Lab
Gene Symbol Fpr2
Ensembl Gene ENSMUSG00000052270
Gene Nameformyl peptide receptor 2
SynonymsE330010I07Rik, Fpr-rs2
MMRRC Submission 040813-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R3906 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location17887824-17893952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17893549 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 269 (K269R)
Ref Sequence ENSEMBL: ENSMUSP00000065799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054871] [ENSMUST00000064068] [ENSMUST00000149944]
Predicted Effect probably benign
Transcript: ENSMUST00000054871
SMART Domains Protein: ENSMUSP00000093316
Gene: ENSMUSG00000079700

DomainStartEndE-ValueType
Pfam:7tm_1 43 302 2.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064068
AA Change: K269R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000065799
Gene: ENSMUSG00000052270
AA Change: K269R

DomainStartEndE-ValueType
Pfam:7tm_1 43 302 4.3e-36 PFAM
low complexity region 326 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149944
Meta Mutation Damage Score 0.1426 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted reporter allele exhibit altered leukocyte responses and experimentally induced inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,067,151 V1352A possibly damaging Het
Abcb7 G T X: 104,284,159 Q715K probably benign Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Cacng1 C A 11: 107,716,292 V34L probably benign Het
Cd1d1 A G 3: 86,998,756 W71R probably damaging Het
Cdhr3 A G 12: 33,053,428 F397L probably damaging Het
Ces2a A G 8: 104,739,308 I325V probably benign Het
Ctsq C T 13: 61,038,771 V140M probably damaging Het
Cyp4f18 A G 8: 72,001,082 probably benign Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Dsg3 G A 18: 20,538,499 G754R probably damaging Het
Endod1 T A 9: 14,380,855 Y39F probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Frk T G 10: 34,584,056 L216V probably benign Het
Gan G A 8: 117,194,134 V370M probably damaging Het
Grik1 A G 16: 88,006,449 I285T probably benign Het
Hspa1a C T 17: 34,971,727 V67M probably damaging Het
Kbtbd8 T A 6: 95,126,584 Y405N probably damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Kif26a T A 12: 112,176,890 S1193T probably benign Het
Kmt2e A G 5: 23,501,626 N1396D probably benign Het
Lasp1 G A 11: 97,799,827 V12M probably damaging Het
Lrrk1 G T 7: 66,294,903 T653K possibly damaging Het
Meiob A G 17: 24,827,948 Y182C probably benign Het
Myh6 T C 14: 54,956,955 D739G probably benign Het
Ninl T C 2: 150,980,119 D21G probably damaging Het
Olfr1504 C T 19: 13,887,706 C168Y probably damaging Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pacsin2 A C 15: 83,379,055 V125G probably damaging Het
Pfas G A 11: 68,988,286 probably benign Het
Pla2g4f C T 2: 120,300,499 R825Q probably benign Het
Prkd1 A T 12: 50,388,426 V506E possibly damaging Het
Psmd2 A G 16: 20,655,642 D316G probably benign Het
Ryr2 T A 13: 11,738,209 D1742V possibly damaging Het
Szt2 G A 4: 118,378,269 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Xrcc6 A G 15: 82,029,571 T378A probably benign Het
Other mutations in Fpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Fpr2 APN 17 17892772 missense probably damaging 0.98
IGL01481:Fpr2 APN 17 17892763 missense probably benign 0.01
IGL02320:Fpr2 APN 17 17893346 missense probably benign 0.05
IGL02479:Fpr2 APN 17 17892812 missense probably benign 0.01
R1553:Fpr2 UTSW 17 17893594 missense possibly damaging 0.87
R4424:Fpr2 UTSW 17 17893132 missense probably damaging 1.00
R4480:Fpr2 UTSW 17 17893753 missense probably benign 0.01
R4521:Fpr2 UTSW 17 17893247 missense probably benign 0.01
R4718:Fpr2 UTSW 17 17893336 missense probably benign 0.00
R5385:Fpr2 UTSW 17 17893047 missense probably benign 0.00
R7184:Fpr2 UTSW 17 17893271 missense unknown
R7233:Fpr2 UTSW 17 17893504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCATGTCAATTGTTGCTG -3'
(R):5'- CTCAATGTCTGCAGGAGGTGAAG -3'

Sequencing Primer
(F):5'- CTGTTTGCTATGGACTCATTGC -3'
(R):5'- GGTTTGACCAGAATCCTCACTCAG -3'
Posted On2015-04-17