Mutagenetix > Incidental Mutation

Incidental Mutation 'R0380:Thnsl2'

30921

Institutional Source

Beutler Lab

Gene Symbol

Thnsl2

Ensembl Gene

ENSMUSG00000054474

Gene Name

threonine synthase-like 2 (bacterial)

Synonyms

TSH2

MMRRC Submission

038586-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R0380 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71128166-71144439 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 71141330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 38 (L38Q)

Ref Sequence

ENSEMBL: ENSMUSP00000124423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074241] [ENSMUST00000160918]

AlphaFold

Q80W22

Predicted Effect

probably damaging
Transcript: ENSMUST00000074241
AA Change: L38Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073861
Gene: ENSMUSG00000054474
AA Change: L38Q

Domain	Start	End	E-Value	Type
Pfam:Thr_synth_N	2	81	2.4e-27	PFAM
Pfam:PALP	93	415	9.6e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000160918
AA Change: L38Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124423
Gene: ENSMUSG00000054474
AA Change: L38Q

Domain	Start	End	E-Value	Type
Pfam:Thr_synth_N	2	81	1.1e-27	PFAM
Pfam:PALP	94	413	8.4e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170455

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.6%
20x: 90.5%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a threonine synthase-like protein. A similar enzyme in mouse can catalyze the degradation of O-phospho-homoserine to a-ketobutyrate, phosphate, and ammonia. This protein also has phospho-lyase activity on both gamma and beta phosphorylated substrates. In mouse an alternatively spliced form of this protein has been shown to act as a cytokine and can induce the production of the inflammatory cytokine IL6 in osteoblasts. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,588,500		probably null	Het
Abca14	A	T	7: 120,278,480	I1073L	probably benign	Het
Adamts17	C	T	7: 67,150,044	P1116L	probably benign	Het
Adgrb2	C	G	4: 130,007,831	P416R	probably damaging	Het
Ano4	A	G	10: 88,978,813	I671T	possibly damaging	Het
Ap1g1	A	G	8: 109,803,164		probably benign	Het
Arhgap19	A	G	19: 41,773,137		probably benign	Het
Arhgap32	C	T	9: 32,246,477	R129W	probably damaging	Het
Atp10b	G	T	11: 43,225,597	A924S	probably damaging	Het
Ccdc180	T	A	4: 45,930,197		probably null	Het
Cckbr	A	G	7: 105,434,991	T311A	probably benign	Het
Cr2	C	T	1: 195,157,407	G947R	probably damaging	Het
Cyp2g1	T	A	7: 26,814,295		probably benign	Het
Dennd1c	G	A	17: 57,073,822	A210V	probably damaging	Het
Doxl2	A	G	6: 48,975,839	I233V	probably benign	Het
Dscam	A	G	16: 97,056,610	Y67H	probably damaging	Het
Dsg2	T	A	18: 20,582,939	Y282*	probably null	Het
Epg5	T	C	18: 77,960,841	L688P	probably damaging	Het
Esr2	T	G	12: 76,123,291	E458A	possibly damaging	Het
Fat1	T	C	8: 45,010,123	S1326P	probably damaging	Het
Flt1	A	G	5: 147,588,572	S919P	probably damaging	Het
Gpr12	T	A	5: 146,583,336	T259S	probably damaging	Het
Grm5	T	A	7: 88,074,376	C625S	possibly damaging	Het
H2-Q1	C	T	17: 35,323,078	H209Y	probably damaging	Het
Hcfc2	C	A	10: 82,728,438		probably benign	Het
Itgal	C	A	7: 127,310,751	Y495*	probably null	Het
Kbtbd3	T	A	9: 4,330,545	Y306*	probably null	Het
Kcns2	T	C	15: 34,839,172	F227S	possibly damaging	Het
Kif1a	T	A	1: 93,056,031		probably null	Het
Maml2	C	T	9: 13,621,100	R537*	probably null	Het
Muc4	G	A	16: 32,752,905	A928T	probably benign	Het
Nav3	A	G	10: 109,758,879		probably benign	Het
Neb	A	T	2: 52,232,202	M605K	probably damaging	Het
Olfr15	A	T	16: 3,838,985	D4V	probably benign	Het
Pcdhb3	T	G	18: 37,302,157	I392S	possibly damaging	Het
Prune2	A	G	19: 17,124,007	T2292A	probably damaging	Het
Rbbp8nl	A	T	2: 180,281,719	M108K	probably damaging	Het
Rbm25	A	G	12: 83,660,356	T259A	probably benign	Het
Recql	C	A	6: 142,369,430	R243L	probably damaging	Het
Rsf1	TGGCG	TGGCGACGGCGGCG	7: 97,579,905		probably benign	Het
Serpinb12	T	C	1: 106,950,821		probably null	Het
Slc16a14	T	A	1: 84,929,530	I8F	possibly damaging	Het
Spef1	G	T	2: 131,172,412		probably benign	Het
Tas2r103	A	G	6: 133,036,203	L300P	probably damaging	Het
Tas2r117	A	T	6: 132,803,588	R230*	probably null	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tmem171	G	T	13: 98,692,027	T205K	possibly damaging	Het
Tmem232	A	T	17: 65,256,448	L650Q	probably benign	Het
Tpr	T	A	1: 150,412,947	D518E	probably benign	Het
Tsen54	T	C	11: 115,822,597	V442A	probably damaging	Het
Tshz3	A	T	7: 36,771,300	I905F	probably damaging	Het
Vmn1r66	C	T	7: 10,274,743	C121Y	probably benign	Het
Wdfy3	T	C	5: 101,948,966	Q322R	probably damaging	Het
Wdr64	T	C	1: 175,769,642		probably benign	Het

Other mutations in Thnsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Thnsl2	APN	6	71131900	missense	probably damaging	1.00
IGL00814:Thnsl2	APN	6	71139883	missense	probably damaging	1.00
IGL01139:Thnsl2	APN	6	71138734	missense	probably damaging	1.00
IGL01380:Thnsl2	APN	6	71138756	missense	probably benign
IGL01511:Thnsl2	APN	6	71139793	missense	probably benign	0.04
IGL02000:Thnsl2	APN	6	71134219	missense	probably damaging	1.00
IGL03157:Thnsl2	APN	6	71131946	missense	probably benign	0.00
R0372:Thnsl2	UTSW	6	71139790	missense	probably damaging	1.00
R0521:Thnsl2	UTSW	6	71134259	missense	probably damaging	1.00
R0815:Thnsl2	UTSW	6	71134224	nonsense	probably null
R0863:Thnsl2	UTSW	6	71134224	nonsense	probably null
R1300:Thnsl2	UTSW	6	71134191	missense	probably damaging	1.00
R2867:Thnsl2	UTSW	6	71131961	missense	probably damaging	1.00
R2867:Thnsl2	UTSW	6	71131961	missense	probably damaging	1.00
R4767:Thnsl2	UTSW	6	71134295	missense	probably damaging	1.00
R5578:Thnsl2	UTSW	6	71138765	missense	probably benign	0.40
R5818:Thnsl2	UTSW	6	71134143	missense	probably benign	0.01
R6627:Thnsl2	UTSW	6	71134215	missense	possibly damaging	0.70
R6800:Thnsl2	UTSW	6	71141280	missense	probably benign	0.29
R7192:Thnsl2	UTSW	6	71139755	missense	probably benign	0.02
R7391:Thnsl2	UTSW	6	71131930	missense	probably damaging	1.00
R7516:Thnsl2	UTSW	6	71132006	nonsense	probably null
R7565:Thnsl2	UTSW	6	71141327	missense	probably benign	0.00
R7980:Thnsl2	UTSW	6	71138668	missense	probably damaging	1.00
R7988:Thnsl2	UTSW	6	71141319	missense	probably benign	0.38
R8170:Thnsl2	UTSW	6	71129333	missense	probably benign	0.05
R8917:Thnsl2	UTSW	6	71139943	missense	probably benign
R9547:Thnsl2	UTSW	6	71139826	missense	probably damaging	1.00
R9696:Thnsl2	UTSW	6	71131946	missense	possibly damaging	0.95
X0021:Thnsl2	UTSW	6	71128704	missense	probably benign	0.02
X0066:Thnsl2	UTSW	6	71139837	nonsense	probably null
Z1177:Thnsl2	UTSW	6	71128841	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACTTGCAACTCAGGGAGGGAGTATG -3'
(R):5'- ACCTCAAGGTAGGACACTCAGTGG -3'

Sequencing Primer
(F):5'- GAGGGAGTATGTGGCACTG -3'
(R):5'- GTCAGAGGACTCCGTATACTTAGC -3'

Posted On

2013-04-24