Incidental Mutation 'R0380:Thnsl2'
ID30921
Institutional Source Beutler Lab
Gene Symbol Thnsl2
Ensembl Gene ENSMUSG00000054474
Gene Namethreonine synthase-like 2 (bacterial)
SynonymsTSH2
MMRRC Submission 038586-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R0380 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location71128166-71144439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71141330 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 38 (L38Q)
Ref Sequence ENSEMBL: ENSMUSP00000124423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074241] [ENSMUST00000160918]
Predicted Effect probably damaging
Transcript: ENSMUST00000074241
AA Change: L38Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073861
Gene: ENSMUSG00000054474
AA Change: L38Q

DomainStartEndE-ValueType
Pfam:Thr_synth_N 2 81 2.4e-27 PFAM
Pfam:PALP 93 415 9.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160918
AA Change: L38Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124423
Gene: ENSMUSG00000054474
AA Change: L38Q

DomainStartEndE-ValueType
Pfam:Thr_synth_N 2 81 1.1e-27 PFAM
Pfam:PALP 94 413 8.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170455
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a threonine synthase-like protein. A similar enzyme in mouse can catalyze the degradation of O-phospho-homoserine to a-ketobutyrate, phosphate, and ammonia. This protein also has phospho-lyase activity on both gamma and beta phosphorylated substrates. In mouse an alternatively spliced form of this protein has been shown to act as a cytokine and can induce the production of the inflammatory cytokine IL6 in osteoblasts. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,588,500 probably null Het
Abca14 A T 7: 120,278,480 I1073L probably benign Het
Adamts17 C T 7: 67,150,044 P1116L probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Ano4 A G 10: 88,978,813 I671T possibly damaging Het
Ap1g1 A G 8: 109,803,164 probably benign Het
Arhgap19 A G 19: 41,773,137 probably benign Het
Arhgap32 C T 9: 32,246,477 R129W probably damaging Het
Atp10b G T 11: 43,225,597 A924S probably damaging Het
Ccdc180 T A 4: 45,930,197 probably null Het
Cckbr A G 7: 105,434,991 T311A probably benign Het
Cr2 C T 1: 195,157,407 G947R probably damaging Het
Cyp2g1 T A 7: 26,814,295 probably benign Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
Doxl2 A G 6: 48,975,839 I233V probably benign Het
Dscam A G 16: 97,056,610 Y67H probably damaging Het
Dsg2 T A 18: 20,582,939 Y282* probably null Het
Epg5 T C 18: 77,960,841 L688P probably damaging Het
Esr2 T G 12: 76,123,291 E458A possibly damaging Het
Fat1 T C 8: 45,010,123 S1326P probably damaging Het
Flt1 A G 5: 147,588,572 S919P probably damaging Het
Gpr12 T A 5: 146,583,336 T259S probably damaging Het
Grm5 T A 7: 88,074,376 C625S possibly damaging Het
H2-Q1 C T 17: 35,323,078 H209Y probably damaging Het
Hcfc2 C A 10: 82,728,438 probably benign Het
Itgal C A 7: 127,310,751 Y495* probably null Het
Kbtbd3 T A 9: 4,330,545 Y306* probably null Het
Kcns2 T C 15: 34,839,172 F227S possibly damaging Het
Kif1a T A 1: 93,056,031 probably null Het
Maml2 C T 9: 13,621,100 R537* probably null Het
Muc4 G A 16: 32,752,905 A928T probably benign Het
Nav3 A G 10: 109,758,879 probably benign Het
Neb A T 2: 52,232,202 M605K probably damaging Het
Olfr15 A T 16: 3,838,985 D4V probably benign Het
Pcdhb3 T G 18: 37,302,157 I392S possibly damaging Het
Prune2 A G 19: 17,124,007 T2292A probably damaging Het
Rbbp8nl A T 2: 180,281,719 M108K probably damaging Het
Rbm25 A G 12: 83,660,356 T259A probably benign Het
Recql C A 6: 142,369,430 R243L probably damaging Het
Rsf1 TGGCG TGGCGACGGCGGCG 7: 97,579,905 probably benign Het
Serpinb12 T C 1: 106,950,821 probably null Het
Slc16a14 T A 1: 84,929,530 I8F possibly damaging Het
Spef1 G T 2: 131,172,412 probably benign Het
Tas2r103 A G 6: 133,036,203 L300P probably damaging Het
Tas2r117 A T 6: 132,803,588 R230* probably null Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmem171 G T 13: 98,692,027 T205K possibly damaging Het
Tmem232 A T 17: 65,256,448 L650Q probably benign Het
Tpr T A 1: 150,412,947 D518E probably benign Het
Tsen54 T C 11: 115,822,597 V442A probably damaging Het
Tshz3 A T 7: 36,771,300 I905F probably damaging Het
Vmn1r66 C T 7: 10,274,743 C121Y probably benign Het
Wdfy3 T C 5: 101,948,966 Q322R probably damaging Het
Wdr64 T C 1: 175,769,642 probably benign Het
Other mutations in Thnsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thnsl2 APN 6 71131900 missense probably damaging 1.00
IGL00814:Thnsl2 APN 6 71139883 missense probably damaging 1.00
IGL01139:Thnsl2 APN 6 71138734 missense probably damaging 1.00
IGL01380:Thnsl2 APN 6 71138756 missense probably benign
IGL01511:Thnsl2 APN 6 71139793 missense probably benign 0.04
IGL02000:Thnsl2 APN 6 71134219 missense probably damaging 1.00
IGL03157:Thnsl2 APN 6 71131946 missense probably benign 0.00
R0372:Thnsl2 UTSW 6 71139790 missense probably damaging 1.00
R0521:Thnsl2 UTSW 6 71134259 missense probably damaging 1.00
R0815:Thnsl2 UTSW 6 71134224 nonsense probably null
R0863:Thnsl2 UTSW 6 71134224 nonsense probably null
R1300:Thnsl2 UTSW 6 71134191 missense probably damaging 1.00
R2867:Thnsl2 UTSW 6 71131961 missense probably damaging 1.00
R2867:Thnsl2 UTSW 6 71131961 missense probably damaging 1.00
R4767:Thnsl2 UTSW 6 71134295 missense probably damaging 1.00
R5578:Thnsl2 UTSW 6 71138765 missense probably benign 0.40
R5818:Thnsl2 UTSW 6 71134143 missense probably benign 0.01
R6627:Thnsl2 UTSW 6 71134215 missense possibly damaging 0.70
R6800:Thnsl2 UTSW 6 71141280 missense probably benign 0.29
R7192:Thnsl2 UTSW 6 71139755 missense probably benign 0.02
R7391:Thnsl2 UTSW 6 71131930 missense probably damaging 1.00
R7516:Thnsl2 UTSW 6 71132006 nonsense probably null
R7565:Thnsl2 UTSW 6 71141327 missense probably benign 0.00
R7980:Thnsl2 UTSW 6 71138668 missense probably damaging 1.00
R7988:Thnsl2 UTSW 6 71141319 missense probably benign 0.38
R8170:Thnsl2 UTSW 6 71129333 missense probably benign 0.05
X0021:Thnsl2 UTSW 6 71128704 missense probably benign 0.02
X0066:Thnsl2 UTSW 6 71139837 nonsense probably null
Z1177:Thnsl2 UTSW 6 71128841 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTGCAACTCAGGGAGGGAGTATG -3'
(R):5'- ACCTCAAGGTAGGACACTCAGTGG -3'

Sequencing Primer
(F):5'- GAGGGAGTATGTGGCACTG -3'
(R):5'- GTCAGAGGACTCCGTATACTTAGC -3'
Posted On2013-04-24