Incidental Mutation 'R3902:Mettl21a'
ID309213
Institutional Source Beutler Lab
Gene Symbol Mettl21a
Ensembl Gene ENSMUSG00000025956
Gene Namemethyltransferase like 21A
Synonyms2310038H17Rik, Fam119a
MMRRC Submission 040811-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3902 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location64606473-64617242 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64608081 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 106 (V106I)
Ref Sequence ENSEMBL: ENSMUSP00000109713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053469] [ENSMUST00000087366] [ENSMUST00000114079]
Predicted Effect probably benign
Transcript: ENSMUST00000053469
AA Change: V106I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000050424
Gene: ENSMUSG00000025956
AA Change: V106I

DomainStartEndE-ValueType
Pfam:Methyltransf_16 25 190 1.8e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087366
SMART Domains Protein: ENSMUSP00000084624
Gene: ENSMUSG00000025958

DomainStartEndE-ValueType
internal_repeat_1 16 90 1.46e-5 PROSPERO
Pfam:pKID 99 141 5.3e-24 PFAM
low complexity region 148 160 N/A INTRINSIC
internal_repeat_1 170 247 1.46e-5 PROSPERO
BRLZ 267 325 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114079
AA Change: V106I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109713
Gene: ENSMUSG00000025956
AA Change: V106I

DomainStartEndE-ValueType
Pfam:Methyltransf_16 25 190 1e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162806
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Eif2b3 C T 4: 117,022,207 R15W probably damaging Het
Eprs G A 1: 185,379,742 probably null Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbxl20 T A 11: 98,097,035 T61S probably benign Het
Fry A G 5: 150,345,927 E211G probably damaging Het
Gatd1 A G 7: 141,409,101 L215P probably damaging Het
Gm14698 A G X: 68,821,647 M101V probably benign Het
Gm15922 G A 7: 3,737,277 T315I probably damaging Het
Gys2 A G 6: 142,472,800 M1T probably null Het
Hacd4 A C 4: 88,437,501 I49R probably damaging Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Klhl26 T C 8: 70,452,366 D217G probably damaging Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Mpdz A G 4: 81,307,116 V1427A probably damaging Het
Mug2 A T 6: 122,075,567 D1024V probably damaging Het
Myl7 T A 11: 5,898,430 K38M probably damaging Het
Myl7 T G 11: 5,898,431 K38Q probably damaging Het
Myom2 T C 8: 15,104,165 V701A probably benign Het
Nipbl A G 15: 8,350,246 S1021P possibly damaging Het
Optc A G 1: 133,897,963 M275T probably benign Het
Pclo A T 5: 14,712,522 T385S probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Plekhn1 T A 4: 156,225,669 I63F possibly damaging Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Rassf1 A G 9: 107,554,840 Y21C probably damaging Het
Slc12a1 A T 2: 125,188,193 I562F probably damaging Het
Slc16a6 A G 11: 109,458,561 S141P probably damaging Het
Sntn T C 14: 13,679,084 L86P probably damaging Het
Taar4 T A 10: 23,961,015 N174K probably damaging Het
Trav12-3 G T 14: 53,622,029 C44F probably damaging Het
Triml2 A G 8: 43,190,360 R240G probably benign Het
Vmn1r3 A G 4: 3,185,241 M22T probably benign Het
Vmn2r7 C A 3: 64,719,516 Q26H possibly damaging Het
Vmn2r72 T C 7: 85,749,735 D470G possibly damaging Het
Xpo6 A G 7: 126,120,409 Y602H probably damaging Het
Zfp287 T C 11: 62,712,202 T241A probably benign Het
Zfp386 A G 12: 116,060,155 K498E probably damaging Het
Zzef1 T C 11: 72,908,500 L2392P probably damaging Het
Other mutations in Mettl21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02500:Mettl21a APN 1 64608054 missense probably benign 0.13
R2219:Mettl21a UTSW 1 64616283 missense probably damaging 1.00
R2220:Mettl21a UTSW 1 64616283 missense probably damaging 1.00
R4224:Mettl21a UTSW 1 64607956 nonsense probably null
R5715:Mettl21a UTSW 1 64615155 missense probably benign 0.00
R7611:Mettl21a UTSW 1 64615107 missense probably benign 0.05
R7734:Mettl21a UTSW 1 64608129 missense probably damaging 1.00
R7886:Mettl21a UTSW 1 64615184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCGTTCATAGCGGATTCG -3'
(R):5'- GTATGGTATTCTGCAAAATAGCTGG -3'

Sequencing Primer
(F):5'- TTCATAGCGGATTCGGCAAGC -3'
(R):5'- AGCTGGATATTTAGAGAATGCCCTG -3'
Posted On2015-04-17