Incidental Mutation 'R3902:Vmn1r3'
ID309221
Institutional Source Beutler Lab
Gene Symbol Vmn1r3
Ensembl Gene ENSMUSG00000115466
Gene Namevomeronasal 1 receptor 3
SynonymsGm11778
MMRRC Submission 040811-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R3902 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location3184348-3185358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3185241 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 22 (M22T)
Ref Sequence ENSEMBL: ENSMUSP00000100790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105159]
Predicted Effect probably benign
Transcript: ENSMUST00000105159
AA Change: M22T

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100790
Gene: ENSMUSG00000115466
AA Change: M22T

DomainStartEndE-ValueType
Pfam:TAS2R 6 302 1.7e-9 PFAM
Pfam:7tm_1 30 292 5.1e-7 PFAM
Pfam:V1R 34 298 1.2e-35 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Eif2b3 C T 4: 117,022,207 R15W probably damaging Het
Eprs G A 1: 185,379,742 probably null Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbxl20 T A 11: 98,097,035 T61S probably benign Het
Fry A G 5: 150,345,927 E211G probably damaging Het
Gatd1 A G 7: 141,409,101 L215P probably damaging Het
Gm14698 A G X: 68,821,647 M101V probably benign Het
Gm15922 G A 7: 3,737,277 T315I probably damaging Het
Gys2 A G 6: 142,472,800 M1T probably null Het
Hacd4 A C 4: 88,437,501 I49R probably damaging Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Klhl26 T C 8: 70,452,366 D217G probably damaging Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Mettl21a C T 1: 64,608,081 V106I probably benign Het
Mpdz A G 4: 81,307,116 V1427A probably damaging Het
Mug2 A T 6: 122,075,567 D1024V probably damaging Het
Myl7 T A 11: 5,898,430 K38M probably damaging Het
Myl7 T G 11: 5,898,431 K38Q probably damaging Het
Myom2 T C 8: 15,104,165 V701A probably benign Het
Nipbl A G 15: 8,350,246 S1021P possibly damaging Het
Optc A G 1: 133,897,963 M275T probably benign Het
Pclo A T 5: 14,712,522 T385S probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Plekhn1 T A 4: 156,225,669 I63F possibly damaging Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Rassf1 A G 9: 107,554,840 Y21C probably damaging Het
Slc12a1 A T 2: 125,188,193 I562F probably damaging Het
Slc16a6 A G 11: 109,458,561 S141P probably damaging Het
Sntn T C 14: 13,679,084 L86P probably damaging Het
Taar4 T A 10: 23,961,015 N174K probably damaging Het
Trav12-3 G T 14: 53,622,029 C44F probably damaging Het
Triml2 A G 8: 43,190,360 R240G probably benign Het
Vmn2r7 C A 3: 64,719,516 Q26H possibly damaging Het
Vmn2r72 T C 7: 85,749,735 D470G possibly damaging Het
Xpo6 A G 7: 126,120,409 Y602H probably damaging Het
Zfp287 T C 11: 62,712,202 T241A probably benign Het
Zfp386 A G 12: 116,060,155 K498E probably damaging Het
Zzef1 T C 11: 72,908,500 L2392P probably damaging Het
Other mutations in Vmn1r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03130:Vmn1r3 APN 4 3185214 missense possibly damaging 0.89
PIT4131001:Vmn1r3 UTSW 4 3184691 missense probably damaging 1.00
PIT4131001:Vmn1r3 UTSW 4 3184774 missense probably benign 0.02
PIT4142001:Vmn1r3 UTSW 4 3184691 missense probably damaging 1.00
PIT4142001:Vmn1r3 UTSW 4 3184774 missense probably benign 0.02
R0972:Vmn1r3 UTSW 4 3185125 missense probably damaging 1.00
R1423:Vmn1r3 UTSW 4 3185231 missense probably damaging 1.00
R4999:Vmn1r3 UTSW 4 3185009 nonsense probably null
R6091:Vmn1r3 UTSW 4 3184684 missense probably damaging 0.97
R6140:Vmn1r3 UTSW 4 3185031 missense probably damaging 0.97
R6188:Vmn1r3 UTSW 4 3185017 missense probably damaging 1.00
R6299:Vmn1r3 UTSW 4 3185098 missense possibly damaging 0.95
R6303:Vmn1r3 UTSW 4 3184975 missense probably damaging 1.00
R6304:Vmn1r3 UTSW 4 3184975 missense probably damaging 1.00
R6317:Vmn1r3 UTSW 4 3184993 missense probably benign 0.39
R6430:Vmn1r3 UTSW 4 3184971 missense probably benign
R6633:Vmn1r3 UTSW 4 3184971 missense probably benign
Z1177:Vmn1r3 UTSW 4 3185304 start codon destroyed probably null 0.60
Predicted Primers PCR Primer
(F):5'- CATCCCATGTCATCTAGGAAATTC -3'
(R):5'- ACTGCCAGCATAGACAAGGG -3'

Sequencing Primer
(F):5'- ATGTCATCTAGGAAATTCTTAAACCC -3'
(R):5'- CACCTTTTTGCAGTGAGAGAAC -3'
Posted On2015-04-17